Description :
From Genome Similarity Track
Location :
contig_80:8115- 9993
Transcript NameFunction/comments
g10276.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
ACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTA
AAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCG
TCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACA
AGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAG
CTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTC
GACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCA
GCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGACGA
GGACGTGGCGATCTGCCTGTTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAGCTGCGATCGCAAGACGTC
GTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGT
CTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGGTCGACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGG
CAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAGCTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCA
CTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCC
ATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGACCATCGTGGAACGAGTGGTTCTGCCCAAC
GGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCC
AAGTCGTGTTCGACGGCACCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGCTCCAGAC
GCCTCAGCGATCGGCGAATGCGGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGGTCGAC
AACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGCGGCTGTCAGAAAAGGCTTGGTCGGTTGATGGCAAAATGCAAAG
TGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGA
GTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCGTAATCC