Description :
From Genome Similarity Track
Location :
Scaffold_885:8112- 9118
Sequence
1006 bases(100 bases per row)
CGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCAGTGGGATGATAGCCGAGTTCATTCTCCTTGAGTACGCGTCCG
CAGAAGCGAACTGGGTGCAGCTTGGCGTCGTGCGGTTGCATTAAAGTACTGCTCAGTGCCCACTCATTTGCGTACAACATTATATGGACTTCTTTCGCCG
AGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGGTCAAAGTCCGT
ATCCTTGAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTCAGAGCACCGAGGAAAGCTTGCATCCCTTTCTTT
GATTTCGGGAAGGCGAGCTCAGCGATCGCGGTTATCTTCTTCGCGTCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGCT
GGACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGGCATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCCC
TCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAGCACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCGG
TTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGCCGAGCT
CAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCAATCCGTTCAGCAAACAACTGCCATCCTCCCTTTGGTTGAACATATCCCCATAGAGCGTTGTC
AATCAGTCGTTGGTAGATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTGTCCAAGCGCACAGACGAACGCTGAGATTCTGCCG
AGCTCG