Description :
From Genome Similarity Track
Location :
Scaffold_7:81117- 83318
Sequence
2201 bases(100 bases per row)
CCCTGATGGCTGCGACGATATGGTCAACCTCAACTACCTGCACGAGCCGGCCATCTTGTATAACCTCAAGCAGCGCTTCTTCCGCCAGATTCCCTACACA
TACACAGGCCCCATCTGTATTGCCGTGAACCCGGTACGTGTCCCTCCCGTaCCCCcTGTCtcccATGCAACTTCAACATGACACTGATGGCATGGCTCTa
CTCCCCAGTATGCATGGCTCGATATCTACACGACCGAGCAGCAGGAGCAGTACCTCATCAAGGACCGCACGGAGCTGCCGCCGCACGTGTATGCCACGAG
TGCCGGCGGCTACCAGCACATGCGCATGTTCGGCGAGGACCAGAGTATCCTCGTCAGTGGCGAgTCGGGCGCAGGCAAgACGGAAACGACCAAGATCTTG
ATGTCGCACCTCGCGATCGCGGgCGACAACACGCTCGCCAAGAGTCCGACGGACACGCCCGTGGGCGAGAAGAGCATCATTGAACGTGTGCTGCACGCCA
ACCCTCTCATGGAGTCGTTCGGTAACGCCAaGACGTCGCGCAATGACAACTCGTCGCGCTTTGGTAAGTTCTCGGAGCTGCagTTCAACCAAGTGGGCCA
GCTCATCGGTGCTCGTTCGCGCACGTATCTGCTGGAGAAGTCTCGTGTGTCCATCcAAGGACAGGACGAGCGCAACTACCACATCTTCTACCAGTTGCTG
GCGTCGGATGACGACGTGACGGCGCAGGTCCAAGTCCAAGGGATGAAGCCGGCCGATTTCCCCATCACAGAGCCGCGTGGTGAGGGCGTGAACGACGGTA
TGAAGGACGCCCAACGCTTCAAGCAGACAGTATCGTGCCTGGAGACAATGGGCGTGGCCAAGGAAGACCAGATCCACATTTTCAAGGTCGTAGCTGCGAT
TCTTCATCTCTCGCGCTTGCAGTTTGAAGTGCTGGACGGCAACGATGATGCCTCGCGgCTCGCGAcaGATGCAGCGAACACGAACACACAGTCGATTATT
TCCCAACTGCTCGGTCTGTCGTCCGAAGAGGACTTGCGTACTGCCCTTTGTACGCGGCAAATGTCGCTGTCGGCGGTGACAGAGACGTATCTGGTGCCAC
TGAATGTGCAGCAGGCGCAGGGCGTGCGCACGGCGTTGTCGGTCGCTCTCTACTCGCATTTGTTCCAGTGGCTCATTCACCGCGTCAACGAATCGACCAG
TGCGCCGCTCGCGGACGTGGTGAACAAGATTTGtATCCTTGATATCTTCGGTTTCGAGATCTTTGAGAAGAACTCGTTCGAGCAGCTCTGTATCAACTAC
GCCAACGAAAAGCTGCAGCAGAAGTTCACGCAGGATGTGTTCAAGACCATTCAAACCGAGTACGAAGAGGAAGGCATCCCTTGGACCAAGATTGAGTTCG
CGGATAACGCCAACGTTCTTGCGCTTATCGAAGGTCGATTTGGTGTGCTGTCGCTGCTGAATGAAGAGTGCATGCGACCAAAGGGTAGTGATGCGGCGTT
TGCGAACAAGCTgAaGGCGCActACGGCGACAATGACCGCTTCGAGACGCCTCGACTGGCGaGAGACTCGTTTATCATCAAGCACTATGCGGGTCCCGTG
CAGTACGATACCAATGGGTTCCTTCTCAAGAACACCGATGCGCTGCAGAACGATctGATCGTGCTCATCGGCAAGAGTTCTTCTCCATTCGTAAAGAAGC
TGTTTGCTGAAGAGAGTCAGAAGGATGCTGGCGCCGCACCACCAACCAACCGTCAGTCCATGCTCAAGCGCCGTACGTCGATCATTGCGGACACGGTTGG
CACGCAGTTCAAGAGCCAGTTGAATGGCCTGATGGAAGACATCCGCCGTACGAATGTCCACTACATCCGTTGCATCAAGCCAAACAGCAAGAAGAGCCcG
CACGTGTTCTGCAAGCAGCGAGTGACGGAGCAGTTGCAGTGTGCTGGTGTCGTGGAGGCTGTGCGTATTAGTCGAATGGCCTACCcGAACCGTATCCTGC
AGACTGTGTtCCTGGAGCGCTTCCGTGGCCTCGCACATGGTGCCATTGCTCCTGTGTCGACTGCCACTTCCTCGGAGgAGGCGATCACGAACGCTGCTCG
CGATCTACTCCAGAACcACCTTCTCAAGGACAAGGAAAGCGAGTACCAAATTGGTAAGACGCGTGTATTCTTCCGCAAGGGCGCTTTGGAAGCACTTGAA
G