Description :
From Genome Similarity Track
Location :
Scaffold_70:81114- 86465
Transcript NameFunction/comments
Phyta_totarag2860eukaryotic translation initiation factor 5B
Phyta_totarag2861conserved hypothetical protein

Sequence
5351 bases(100 bases per row)
TTCTGTCAAATTCCCTTTTGTGTTGCCTTCAgtatgtaccggtaccggtatggTCGGGTAGAACCATGTGAGCCATTGATTGAATGCCGACCAAGTCCCA
GATCGATCCCTCCACATCCACTGAAGACGAATCGAGCCAAAATGGCGCCGAAAACGGggaagaagaacgccaagaaggccgccACCTCGGACGACCTTGA
CGACTTGTTGAACGAGTTCGCGCCCACTGAGGCCGCCAAgccgcagcaggagcagaagaagcagcagaatcaggaggaggaggacaagaagcaggagaag
aaggacgtggacgccgccgccgccgcgtaCCTGGCGTCTCTAGGCGTGGCCCCCGCCGCTGGaggcgagaagaaggacgacaagaagaagaagaaaaagg
gcaagaagaaacccAATGcggacgccaagaaggacgacgacaagaagcccATGTCGGCCGCGGCCAAGGCGCTAATGGAGCGCCAGGCGGCCATGAAGGC
CGAGCAGGAGcggctggagcaggagcatctggagcaggagcgcaTCGcccaggaggaggaagccaaGCACCTGGCGGAGCtcgagcaggaggaggagatc
cgccgcaagaagaaggaggcgcgcgcggccaagatcgagcggcagaagaaggagggcACGTACATGACCAAGGCCCAGAAACAGAAGGCGGCCAAGGCCC
AGGCAGCGCTGGAGGCCATGCAGCAGGCGGGTCTCGTGCCGGAGGCTGctggcgagaagaagaaggtggtgtATTCAGAtagcaagaagaagaacaagaa
gaagaacgacaagaaggaggagccgAAGAAGGTCGAGCCGAAGAGGGTTGTTgtgaaggaggaagaagaggaatTCGAGGACTgggaggcggcggaggac
GCCGCGCaggtgcaggaggaggaggaggctgaggcGCCCGATGCGTGGGACGACGAGGACTGGGAGAccagcgacgtcgtggccTCACTGGaagacaagc
tgcaggaggtcAAGGAagaaactgctgctgccgctgatAGCGACAGTGACGGAGACGAGGATCTGCTGGTactggagcagaagaaggagcaggagcgtcT
GCGTCAGCAAGGCATTGCGCTGAAGAAGCGtcaggaggagcaggccgAGCAGATGCGTCAGGAGGCCGAGCAGGAGCATCAGCGCTCCAAGGCTAAGCTC
GAGGCcgaccgcaagaagaaggaggctgCCGAGCGTCGTCGCGAGCGTGAGGCCGCCGCACGTGCTAATGTGTCGCTGGACAACCTGCGTTCGCCTATTT
GCTGTATCATGGGTCACGTTGATACTGGTAAGACGAAGTTGCTCGACAACATCCGTAAAACTAAGGTGCAGGACGCCGAAGCCGGTGGTATTACCCAGCA
GATTGGTGCGACCTTCTTCCCTGTGGAGGCTATCAAGCAAAAGACGGCACGGCTCGTCGAGACAATGAAGTTGGAGTTCCGCCTGCCCGGTCTGCTTGTG
ATCGATACGCCCGGTCACGAGTCGTTCACGAACCTGCGTAATCGTGGTTCATCGCTGTGTGATATCGCCATCTTGGTGGTTGACATTATGCACGGTCTGG
AACCTCAGACTCTAGAATCactgcgcctgctgcgccagAAGAAGGCACCATTTGTTGTTGCGCTCAATAAGATCGATCGTTGCTACGGCTGGAAGACGAT
GCCCGACATGCCCATCCAGGAGGCACTTAAGCACCAGAACGAGCACGTCATTCGCGAGTTTGAGGACCGCATGAAGGCGATCATTGTGGAATTtgccgag
cagaagctgaacgccGAGGTGTACTGGCGCAACAAGGACTTGGCACGCACGGTCTCGCTCATCCCTACCAGTGCTATCTCGGGTGAGGGTGTGCCGGATA
TGCTGATGATGCTGACGCGATTGACGCAGGAGCGTATGGCGGAGTCGTTGGCGTTCGTTGACATCTTGCAGTGTACCGTGCTGGAAGTGAAGGTTATCGA
GGGTCTCGGTACGACGATTGATACGATTTTGGTGAATGGTACACTGGAAGAAGGAACCACTATTGTAGTGTGTACATTGGATGGGCCTGTTGTGACAACT
ATCCGTTCGTTGCTAACTCCGCACCCCATGAAGGAAATCCGTGTCAAGGGCGAGTacgtccaccaccagaagatgaaggctgCAATGGGTGTGAAAATTT
GCGCGCAGGGTCTTGAGAAGGCGGTTGCTGGTACACAGATTTACGTGGTTGGCCCCGATGACGATgtcgaggagctgaaggactCTGTCATGTCCGACCT
GACGGGAATTTTGGATTCGGTGAAGGCTACTCGCCGCGGTGTGATGGTTCAAGCTTCTACCCTGGGTGCGTTGGAGGCGCTTCTGGAGTTCTTGCGCACG
TGTGACCCACCCATTCCGGTGTCCTGTGTGAATATCGGCCCCGTACACAAGAAGGACGTTATGCGAGCCTctgtgcagctcgagcaccaGCCCGAGTTTG
GTACTATTCTGGCGTTCGACGTGAAGGTCCACAGCGACGCTACTGAGCTGGCATCTGAGCTCGGCGTGCGCATTTTCACGGCCGACATCATTTACCACCT
GTTCGATCAATTCACGGCGTACATGGACAACTTCCGTATGGCTCGCCGTGAGGAATTCGAGGAGGTTGCCGTGTTCCCCTGCGTGCTCAAGATCCTTCcc
aactgcgtcttcaacaagaaggacCCGATCATTCTCGGTGTCGACATCGAAGAGGGTATCCTCAAGATCGGTACCCCCCTCGTGGTGCCGTCCGCCGGTA
GCTTTTTGGTCGGCAAGGTGGGCTCCATCGAGCGCGAGCACAAGGAGGTGGATCGCGCGAAGAAGGGCGCGTCGGTGGCCGTGCGGATAGACAACGAGGG
CAGCGTCATGTACGGTCGCCACTTCGACCACAAGAACAAGCTGGTGTCGCGCTTGACCCGCCAGAGCATCGACGCGCTGAAAGAGAATTTCCGGGAAGac
ctgcagaaggaggactGGCAGCTCGtcatcaagctcaagaaggtgttcGATATCATTTAGAGCGCGCGTGCGACGAGCAGGAAAAGCAGGGAACGTTCGC
GCCCAGAGGGTGTTAAGAGGACCCGATACAGCTCAATCGAGTCCTGTTGAGATCAGAGTAGGTTCATATGTTTACCAATATATGATTTTCGTTCGTCGAC
ATGCAGGAGCTACCGGATGGAGTTCAGTCGCGTCCGGCACGCTAGTGATATCGCGTCCCAGCCCCTGGACTTGGTTGCTGAACTCCACCACGAGCTATGT
GGGCTAGAGCTCCATTCCAAGCGAGCACGTCACAGCTCCGTCCTAGGTAAAATCAGCTCCGCCTTACCACACCGGAAgccatgtacatgtacagcaccGG
GTGGTGGATGCATGGGTGAACGGAGCATTTGCTTCACATTACCAATAGCTGCTGCATCCTTGGGGTGCTGCTACTTGGCATTTATCAGGGCGGCAACGGA
TTTTCTGCATTGAAACCCAGGCCTTGCAGAAGACGCATGCCGTACGCGCATGAGTCATGAGAAGAGCTGCGAGTCCTGACTTGCTCCACACTTTCAATCC
AATTGCTCTCGCGAAATGTAGTTTTGTGGACCATGTTAACTCGAGATGACCTGGGCGAGCTAGTAGCTCAGCTACACCATCGCTGCGTTGAACATTATAG
TCACACCATATCAGTTGCAGCAAAATCTCTATACCAAACAGCTAGGAATCGTACACACGCACAAGCTTCTGAacgcagctcttcttcgcctaTTGGTGTG
TCGCGTGACGGCGACCGCGGAGTTGAAGGTGGTTGGCAGCGTGACTCGTAATCTCGCAAGGGCCACGACGGTGCACGGGAAGActatccagctgctgcag
cacgcgatGACGAGCCCAAGGTCCAGGTAGTTGGCTCTTGAGTCAAGGCTTTACCCCATGCTATCGAAAAAGCGACTGCAAGTCCtggcgccgccgtcgc
cgccgcccacGGATCCAGTATTGAAGTTGAACAGCTGGAGGATTTGCTGGTCAGTGTGAGACTTTTCTGTCCAGGAGGGACAGCCGAAAGTAAGACATGC
GTCAGTCGGGTGACGAAGCGAGCAGAGAACCCCAGGGAACTGCGCGGTTCAGCAGCGCCCAGACAGCGCTGGACCCACGCGCGAAGCAACGTGCAACATG
GAACGTCGACGTACGTGGCTCCTGTGTATGTCGTCTTTGGGGCGAGTGCAGCCAATGGAAGACCACTGAAAGCAACCAAACCGGCGGCAAgacgaagctg
gagacgcgtCTCCACCTACCGCACTTCGCAATTGGATCtccttcgagcagctccgttcTTTTTCATCCTCACTAGCCACGATCGGCGCCCTCGTCATGAT
GCACAGAATGCGGATGCAACAGCTCAGTCACCTGGAGCGCAACGGGGGTCCGTCAAAGCCGAGCACTCTCCGCGCGATGCGAGTGCCCAAGTTCCTGCGA
AGTCTCTACGACATCCTCCACTACGAGGACCAATCGATCCTGACGTGGTCCAAGGACGGCACGTACTTCCAAATCTTCGACACCAAGCGGCTGGAGATCG
TGGTGCTGCCCAAGTACTTCAAGCACGGCAAGTTCGCGAGCTTCCAGCGCCAACTCAACAACTTTGGCTTCCGCAAGTGGACCAAGACGCAGTCCAGCGT
ATGCACCTtcagccaccaccacctcgtgcGCTGCCACCCGCAGCACCTGGCTGAGTTCATCAGTCGCCGACCACCTGCCAACGGCGTGCGACCGGCAGCC
GACGCTTCTTCACTTGCCAGACGCAAGCGAACATTCACGGAGCTCATGCGGTCCGCCGACGTTGGGACCCCCGCAGCTACAAAGGCTATCAAGCGCGAGA
ACGGCAGCTACAGCCGGGCGTCGCAGTCCACGGACACCAACAATCTGGCCATTGCGACGAACGCTGCTCCAGTCAAGTGCGCGCCGCGATGGGCGACAGA
CCCGATAGGTTTCTTGAAGGCCGGCGAGGTAAACAACGGGACTCCTACCAGCACGTCATCGGAGCAGACGTTCAACTTCTcagtggacgagctgcacgat
ATTATCCTTCCGGTCGCTCCAATGTCGGAGCGTCACGACAGCCGACCCATGGAGAAAATGCTCGAGCTACGAATGTTGAACGAGTGCTTGGATCTTGGGA
CAGCGGGCACTTTGTACGCTGCCTCAAATCACGCGGGTGGCGAGCTGTTTCCATCGCTTCCGTACGCGTGGGATAGCGACACATTTTTCGCTCCAGTCGG
CCGTACGCACTTCGAGCAAGAGCGCGGGCCATGGAGATTGCACTAGTGTAG