Description :
From Genome Similarity Track
Location :
Scaffold_836:8110- 11399
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_836-snap-gene-0.2Protein kinase

Sequence
3289 bases(100 bases per row)
CCGAAGGTTACTCCAGAGCCAGATGATCAGGTATATTCGAGAGCAAAGAGTTGGAAATTGTACACCACAAGCCACAGCCATCATCACTACGAAACAGCAA
TAGTCCACCAGAGCCCAATCAAAACAAAAGTCGTCTTTCTTTATCAAGACACATAAACAAATCAGAGGGGGCCATCTTTTCTGATGCCTCTGTAAGGCTA
GGGAGCTGCCTCGCCCGAACTCTCCTCGCGCGCAATCTCACTCAGTTTGTCCACGACGAACCCCACTCGGACGCGCTCGGACGGCTCCTTCTTGGTCATC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GGAGGCTGGGAGATCTGGAGTGTTGCCCTTTCTCACCACTTGGAACCTGACTGCCGCAGCCAATATGTTCCTGCCCCAGGGGATGTCTCCGCTGATGACC
TCGATGATGCACATCGCGAACGAATACACATCGGAGGCGAATGATGGTCTTCCGCCAGTCAGGTACTCTGGCGACCTCCAGTGGGCAGCTCCCATCTTCT
TCGTCTCGATCTTGANNNNNNNNNNGATGGCTCCTTCTTGGTCATCAACTTGATTAAATGGCGCTGTTTGTCGTTCATGGAGGCTGGGAGGTTTGGAATG
TTGCCTCTTCTCACCACTTGGAACCTGACTGCCGCAGTTAACATGTTCCTGCCCCAAGGGATGTCTCCGCTGATGACCTCGATGATGCACATCGCGAACG
AATACACATCGGAGGCGAGTGATGGCCTTCCACTTGCCAGGTACTCTGGCGACCTCCAGTTCACAGCGCCCATTGCCTTTGACTCGATCTTGACCTCCGC
TTCGTTCAGCAAACAGCTCAGGCCAAAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGATTGTGTTGTTGTCTTCCTCGTA
GCCCATGAGTTTGATCACGACGGGGGTGCCAAGCCATGATGCCTTGAACACTTCTCCGAACGCGCCTCTCCCAACCTGATCAGACAACTTGAACACTAGA
TCTTTCAGGGGTAGAGTCCATGGCGGCGTGGTCTGCAGCATCTTGAGGCCAGCTGAAGTCCAAAGTTCGTGGCTCGTCGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTTCACTTG
ATGTTTGGTCGCTTGGACCACCAAGTTCAGCCTCGTCTTGTTGTGCGAGCTGCGGTGTATGCATCCATCGCCGGATCGGGTCCGCTTCTGAGACTTCCAG
CATGTCCAACAGCCGATCCATCTCAGCGTAAACCACGTTGTTCGTCCCCGCGACTTTGCGGCTTCGCGCACATCGGCGAGCCGAGTACTCTGACAATGTA
GTGCGCAAGTGGCGCTTGAAATTCGACAACGCAATAGTGAGCTGCACGGTTTCAATGTCGTTCACGGTCTTTTTCTGTTGCTGGAGCAGGTCGAACATGA
ACTCGAGTGCTGGGAATACACTCATTGACATCCACGTGTCCTCCTCTGGCAGATGCGCACACTTGAATGCCACGCTATTGAGTGTTTCTGGGATCGTCGA
GCCATTCAGTTCGTTGAACAAGTGGTCACTGAGACTCCGGCTCGGCATCTGTATCGTAGGATCAGAAAGAAGACCGTCAGTTTAAATAAGTACTGGATGC
TGAACATAACTCAGAAAATCGTACCTCGTTGGAGCGTTGATCGTCGCTATCAACTCTCCAGCGCTGCTCACTGTCAAAGGCCAGTTTTGCGAGTCGGTTG
ACGACAAAGTCGATTTTCACGCGCTCAGCTGGATCTTGGTTGCACATCTTCGTGATGAGATCCCACTCATCGTCTGTCATGATGCTCGGACGATCTGGGA
GCTTGCCATCGCAAACGGTGTTCTCGATTTTACGAATACTTATGCCTTTCCACGGCAGCTCGTGCGTTAGGGCTTCCCAGATGCACATGCCGAATGCGTA
GATATTCAACGCAGCAGATGCAGACGTGCGATCCTCGAACCACTCTTTCGCCATCCAGGCCTCCCGTCTGCGCTCACTTCCGACGAAGCGGTTTGGATCC
TCGTGAAGACCAGTCAGCTTTGTGACCAGGTTGGGTCCAACGAGGATGCTTTCGGGGCGAAGATTTCTATGCACAAGACCCCGACTGTGAATGTAGCGAA
GCCCCAGTGCTGCTTGATACAGACACTTCCACATTGCGCCGCCGCGATTCAATTCGTCGTCATGTAGACTCTCGAGCAATTCTCTCCCGCCTCGCATCAG
TTCGTTGACGTAGAACTGAGGTTTTCCAATATTGCACGCGCCAAAGAGCTTGATGACGTTCGGCTGACTGAGCTCAAACCACCGCGACGCAGACTTCTCC
ACCGACAGATCGGTCGTTTCGATTCTTACGTTTGTCTCCCTCCACTTGCCCTCGTAGTGCGGTGAGCGACTGTCTGCGGTTGACGGCACGATCTTCCAGC
TGTGCATTTTCACGTCTTCCCGCGAGATGAACCACGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN