Description :
From Genome Similarity Track
Location :
Scaffold_20:811- 8734
Transcript NameFunction/comments
Phyke_g1233hypothetical protein
Phyke_g1234eukaryotic translation initiation factor 3 subunit, putative
Phyke_g1235hypothetical protein PHYSODRAFT_492857
Phyke_g1236hypothetical protein PHYSODRAFT_492063

Sequence
7923 bases(100 bases per row)
GATGAACGCCAAGAGCATCGAGCTGGCGGCGCAGCTCGTGCCGGCAACGTACATCCAGCAGGGTCTGGATGCGGTACGCTCCCGTGAGAAGTTAGTAACA
ACTTTATTGGCTCAGCGTCGTCTGCCTGACGACGGTTGGGATGACGGTAGcgtggagctgttgctgcagacgctctCAGCGAtggacagcaacaacttcc
gAGGCAGCGCAGGTGCCGGAGAGCGCGAGGCTCGCGTTTTCTCTTCGATTGTCGCGCGCCGTCACTTTTATTTATCGCATGGCGTTGGGAGATCAGGCGA
CGTGGCGGCGGTGCAACCTAAAGCTGCAGGCTCATCGCTCATGGTGCAGTTGGCCAATGCCATGGCCAAAGATGTGCTGCGCTTCGCTGGTCTACGTGCT
GTGGAGTCGGCGCTGGTGCTACCAGTGGCTACTGGCATGTCGCTGACCTTGGTGCTATTGCAATTAAAGGAGACAAAGCCTAACGCACGCTACGTCATCT
GGCCACGCATCGACCAGAAGTCCTGCTTCAAGTCTATTGTTGCGGCAGGTTTAACGCCGTTGGTGCTAGAAACTGTTCTGGTGAAGGAAGCCGGGAAGGT
TGGTGGGCAGTTGCAGACAGACCTAGTGGGGATGGCTGAGCTGCTGAATAGGTACGGGTGTGATAGTGTGTTGGCAGTCATGAGCACCACGAGTTGTTTT
GCGCCTCGAGCTTACGATAGCGTTGAAGAGATTGCGAAGCTCTGCCAGGGGCACGGTGTCGGTAAGAATCATGAGTTTAACAAATATGTTTCGCTTATTA
CTGTTTAACTGGTTTGACCTGTTGGTTGACATGCTGTGTTTTGTCGTGGATCTGAAGCACACGTGATTAACAACGCATATGGCGTGCAGGCATCCAAGTG
CGTCCACCAGGTGGAATTGGCCATGCGCACAGGGCGTGTGGATGCCGTAGTGCAGTCTCTCgacaagaacttcatggtgCCTGTAGGCGGAGCAATTGTT
TGCTCGCCCTCACGAGATGTTATTGATCGCGTGGCGAAATTTTACCCAGGGCGTGCGAGTGCCACCCCGACGCTCGATTTCTTTATCACCATGCTTCAAA
TGGTTTGTTTCGTGGGTAGTGTTGACATTGTCGCTCCCCAACATGTTAACTGGTTTACTTGATACTAGGGACGGAATGGGTATCGACGGCTGCTCGAGGA
TCGTAAACAAATCGCTGGCTACatgcttgagcagcttcaagctctggcaggccaagaaggtgagCGCATGCTACACGTCTCTAGCAATGAGGTAAGCTTA
AGCTTAGCCTTGCTTGCATCTTGAATAGGCCGATTATCTCACCCCACCCTAGATCTCCTTTGCAATGACGCTGGCCACGTTTTGCCCAAATATCGCTGAC
ACGAAAGAAAAATCTCGGCAGCTTACATTGCTCGGCGCAATGCTTTTTTCGCGTGGCGTCTCCGGTGCAAGGTAAGGTCGATTTTTTGCAAATGGTAGAG
GTATAATGTCTAACTTTTGCGATCAGGGTGGTGTCATGTCTCGACAACAAAACCATTGCTGGACACGAATTTAATGCTTTCGGTGCGCACCATAGTGGCT
TCCCAGTAGCATACGTCACCTTTGCTTGCGCGTTGGGGATGCAGCGCTCCGAAGTGGACCAGCTCGTCACAAGATTAAGAAAGACAATCTACGAATGGCG
CGAGAGgcaaagcaaaaatgcagcCCCGGTGAACCAACAGAATGCCGATACGGTGCAGTAGGTGGGCAGTTGTTGCAGGGAAAACAATTCTGCTATGCAA
TCTCTCGAGTTTGATCAAGGCCAAATTGTGTGTCGTTTTTTTCTGTCGCAAACGTTGCTACTTGATGATGGACGCATTTTGAGATGCAACGGTGTCTATA
AAATGTTTTCCTGACAAGGCTATACGCTCCCCCCTCCCctctccaagcagcaaccaagCGTAGTGCTTagtgcttcttgttgccatttttcGACTTTctg
gctttcttcttggccacagGCGCCGATCCAACCGAAGCCTCCTGATCGCCGCTGGTCTTGAACTCGAGCTCTCCGAGCAACTCATTGGCAATCGCGTCGG
CCGCAGCAGCGGCATCGATTTCACGGCGGCCCTTGGCACCCTCTACAGCCTTCTCGGTGAACTTTGCCATAAACTTGGCTGACTCAAGCACACGCGGATC
CTCATCGCCGAACGCCTCCTTAAAAAGCGAGTACACCTTCTTCTCGTACGCAAGTGCTTCGCGGTAGCCACCAGCAAGGCCGCAGGCAAGTGCCATCTGA
TGCAGCGTGTTAGCCGCCTGGTTACGGTCAAATTCTCCGCGGCGAAGAGATTCACGATGACACAGAAGGGCAAGAGTTATCTGTCCCACATCCTGGCACA
TCATGCCCATCTTGAAGTAAAGCGAGCTAATCTCAGGGAAATGAGGCCCACTGCAGAACTCCAATAGGTAGATGGAGCGACGTACGTGCGCCACTGCGAG
ATCCGTCTGGGCGTTCGCGTGCAGGAACAACGCCAAATTTGCGTGGGCGAAAGCAGTGTCGTGATAGTCGATGCCCTGAAGCTGTGTGTACAGTGCCAga
gcacgttgctgctgcgcgatAGCCCCAGCAATATCTCCGGCATGGTAGAGCACCGTAGCCAACGACGAACTGCAGAGAGCCGCGTCCTCGTGGGCACCGC
CACACACCTGGATCAGCAAAGACGACGTCTCTTGAAGGAGTTCGTACGCACTCGACAGCGCACCCTGACTCAAGTTCAACCGACCACGCTCTaggagctg
cttggcctGTGTCAATGGGTGCGCAGGAAGCGAGTTCTTCACTATAGGCACGATACCAGTGATGTCATCGAGGCTGATGGGTGCGGCGCATGACGAAGAG
AAATCGTAGTTGCGGCTGACAACACGAAGACCCAAACGCTGACACAAGCGTCGCAACAATACTGCCTTGTGCACGCGGCCAAGAGGAACGATGGCGCTCT
CGGCAAGTTCTGCACGAGGTTCGCTACGACCCGAACCCCAGAGCGTCAACTCGTAATCGAAACGACACTTAATCTCCTTGTCAATACGGGCCCAAAGTGT
CTTGGCATCCAAAGATGCCACAGTCATATGCGTCGCATCGTCATCCTTGCCATTTGTTTCGCTGCTAGCGTCCTCCGCGGAACCAAGGATGCTGTTCAGA
AGCTTCACAATCGCCGAACCAGGAGCCGCACGAATGGAACCATTAGAGTTCAGCACGTCAGCCAGGATGTGCTTGGTAGCACGAGCAATCATCTctactt
caagcagctccaacatGTACTTGGAGATGCCACCAATAGcctcgagcttcttgcaAAGCGAAGCTAGACGACCAAGATAGCGCATGTTGATACCGCAAGA
GTGCATCAATTGAGTGAGAGCATATCCATCGGCAGGAGCAATGGCACCACGACGCACGTCAGCCACAAACGCTGGCACAACAATCCGCTGCAAATACTCG
GCGGCGTCTTTTGCGGCTGTCTCGTCAGCTTCGAGCTGCTCCGCATCAGTGGACGCCTCATACTTCATGAAGACATTCGGGTTCAAAAGCACCGGAGGga
tctcttcctcttcttcttcctcttctttcTCACCCTCCTCCGTTTCCTTCGGCGACTCAGTCGCGTCCTTAACTTCCGCATTCACTTCAGCAGTATCATT
TTTATCGCCAGTCTCAAGCTCATCATTGGCTTCCTTCTTcgctttctcctcctcagcCTTTTTGGCATCGGCCTCTGCCTTGCGAGTCTCACGCTTGGTA
CGGCGTGTCTGATTCTGCTTCCAGAGCGAGTACAGCTGGACCAACTCTGGTCTCAATAAAGCCACATAGCCTTCATCGTTGCGCGTGAAGACCAAACCAT
CGTCTTCCGGGATCTTCTTGTCTGCTTCGTTCTTGAGAGCAGCATCGCGCTTCGCGTAGAACGTCCAATCCTTAGGGGTGATACGCACGAGATCTAAGAC
ATACAGGCGACCGTCCGATCCTTGAATACCTTTGGCCTCCACGGGACCACTAATCTTGACCACGCTGGTACCTGCTTCACCGCTGCTCACAGGCGTGGCA
CCAAGagcctcctgctccttctcaGCAGCAAGGTCTTCTTCAGTCTTACCAAGTGGCTTGATGTTGCGCTCTGCTATGTGCAGCTTTGCACCAGCCTCGA
GCATCAGCGCATGCATGCCActgttggcagcaatggttTTTCCGCCATCCACAGAGCCATACACAAGCTTGGACGCCGCATCTCCCTGAAGGATACCAGG
GATGACGCTTTGCGCAATCACGCGAACACCAAGGTAGTCCACGACGGTAGTGGCGAGAGTATGTAGCCCGTGAATATCTGCGTCATTGAAGGCTTTGACA
CCCTGCAGGTCACGGTTAGCTGCTGAGTAAGCAGCCTCCTCCCCAGCAGCGGGGTCCTTGGTGGGCTTGTCCTTGCCATCGATAGATAGTGAGAAGAAAA
TGTTATTGAATACGTACACGTGCGCGCTTTCGTCATCCATCGGGTTAATAGGCGGAATGTAGCCCTCAACGATAGCAACAGCGCCTTGGGTTGCAGCTTC
CACAAATTCCGTCACGACCTTGTGCGTAACACGAGCCCGCACAATCTCCTCCTTGATCGTGGTTGCTGGCAGCTCGCGGCAACACTGATATTCCTCATTC
CAGTCTCGCAACACGCCGCGCTCATCCATACCATAGGTTGAGCAAAGCTCGTCTTCGGCGCGGTTAAGATCATACTTGTGCCCCTGTGCCGCCGTCGATA
ATGGCGTGTTCCACGGCAGCTTGCCCCCCAAACTCGATCCCGCGGCTACCATCCACTCAATGGACGAAGGGCCCTGCTTCGCCAGAGAAGCAGCCTTAGC
AAGGAGAGCAGCGTACGAGTTTTTAAACTTCTGCGACACAATGCTGAGCATGTCAAGGAGCAGATGCGCATTGCCCGGAGTGGTCTTGTGCGGGCGTGGA
TCAAAGTTGGAGGCATTGGATCGGTTCACAAAGAAGCCATTGGCGTGCGCTGTGACGTGGAATCGCGTGTTGTCACCTTCGaccaccacctccaggtACA
AAAGATCACCCGCCAGTTTGCGGGGTGCAGGCGGCGGGTTGTAGCCCGAGAAGACGATGCTTTTAATACACGCAGGGAGTTTGGCATCCTGCTGTGGCTC
CTGCTCCTTTTCTTGGTTAGCTTCGTTCTGCTGTTTCTGTTTCTGCTGGGTCTTCTTTcccttctttttcttctggtCCTTGTCGTTTTTCTTGCCCTTG
GCAGGAGGCTGCTCCTGCTCATCTTGCTCctcggcggtggtggcgtcaGGAGAGAAGGCATAGAACTCAGTCAGCTCAGGCTTCACAGGCACTTCAATAC
CTTCCAGCTTCTGGTGGATCTCGCGCAGACGCTTGAGCTGTTGTTCGGAgatctccttgagcttcttctcgtccatctcctcctccgcgGGCGTCTCCTC
CGCCTTGTTTGCATTCTCATCAGCTTCCGGCTGTTCTTCCGGCTCTGATTCTGCCTGAGGAATTGGTGGGTTGCTCAGCACATCGCGGAAGCGACGGACG
TGGTTGCGCACCTTGCGGGCGTCGTacttgtccagcaccataCGCAGCGTCACAccgtccaccacgtcctcGTATTCCCCGAGCTCCACGTAGTCGTTGA
TGGTCTGCCATGTCTGTTCCTCAGCGTTCTGCACCTCCAGGTGGTAGCAGGTGTAGCAGGCAAGCGTGGGGAACTCGGCTATGAGCTGGCGTAGGGACGT
GACAGTGTCGGCTGTGCTCACGTTCTCAAGACGCACAGCCTTGTCGTTCTTGGTGGTGGGAGGCGCGACCATCACAGTGAAGGGTGCATCTTCCATGGCT
ACAAGTTCTtcctgctgcggctgctgctcgactGGGTCGTTGCTGCCCATAATGGAaacttgttgctggtcttgACGCAGTCAGGGCGGAAACCAAATGT
GCGGTTGAGTGTCAACGGCGGCAAATCAAAATCAACCACAGATTGTTTCGTGTACCAGAAATTTGGTACAGTTTTACACTGTACAAGATGCTCCGGGTCC
TTCGTACCTTCAAGCCACGCTCACCTACATCGCTCGCCCGCGCCATGAGCTCAGGTGCAGACGAACGCGCCAACGCCGATGCAGCTGCTACATCCGGTGC
CGCCGCCTCCGTAGGCGAAACCATATTCGACAAGATCCTCCGGAAAGAAATACCCGCCAAGATCGCATACGAGGACGAGCAGTGTCTGGCCTTCCACGAC
GTGAACCCGCAGGCGCCCGTACACATTCTGCTCATCCCCAAGCATCGCGATGGACTCACGCAGCTCGCGCACGCGGAGGAGCACCACGAGGCTATTCTGG
GGCACCTTCTGTACACCGCCAAGCTGgtcgccaagcagcagaatctgGACAGTGGCTTCCGCATTGTTATCAACGACGGAGCCGACGGCTGCCAGTCGGT
CTTCCATCTGCACTTGCACTTGCTGGGTGGACGCAAGTTAGGCTGGCCCCCTGGGTAGAGGGAGGAAGTGTTATTTTGACTGATTTTCTTACTACTGAAG
AATGCCAAGGAGTACAAGTTGAAAGTCGTTTGATTATGGTCAATGGAAAATGAAGTTCCAACGCTATAATGGTGGCATCTTCACATCTTGTACATCTCGA
TAGCTACAGCTCTGGTTCCGTATGACTGGGAGACACTTGGGTTGAGTCTAACCTCGGCCACTGATCTCCATGTAGAACTGATCCAGAAATGCCTCCATGA
ACGTGTGGCGTTCTTCAGCTAAACGCTTGCCAGCATCCGTTTTCATCATACCACGAAGCTTGAGCAGTTTCTGCAAAAACATCAAAAACATCAAAGATCC
CCATGTATATTAGTAGACGGCACGTTGACAGGAGCGAAGACGCAAAGTCGCTTTGGTTGGACCGTACATGCGAGACGTACCTCATAAAAATGgttgatgg
tggtgttgggGCGGTTTGGGTCCATGTACTGCTCTTTGGACATGTCTTTGACCGGGGATACGTTCGGGTCGTAAAGTGGACGCATCTTGTGCCCTCCGAA
AGTGAAGCAACGGGCGATTCCGATCGCTCCAATCGCGTCCTACATATATACAGATAGCAACAAACGATGAGACTCTGCAACCTACACGCAGGCAGGCGAC
AATATCAAACGTACCAGCCGATCAGCGTCCTGTACGCAGCCGTATTCAACGGAGTACGACCTCTGGCGAATCCAGTCAGCAAGTGTTGTTAGTCAGCGAG
TATTCAACTCCTccaccacgaccagcacAATGCACACTAGTAGCTCGTGCATCAATGCAATACCAACCTTTTCGCCGTCTGCCAACTCCTCCTTGAACCC
CATGCATTCGATAATAGCCATTACACGCTCGATCTTGTCGCTAGAAACGTTCTGTGAGTCCAAGAATTCTATCGCGCGCTTCGTGGGCTTGCTCTTGTCA
TACTGGTACTTCCAGTCGTCGATAtcatgcagcagcgccgccagGTCTACAATCTCCAGATTCTCCTCCGGCACACACTGCAAACGTTCGCTATGTTATC
ATACTGTCTGTATCCACACCACCAGTCTGCTCCTTGCACTCACCTCCTCCTTTGCCAGCGTTCGCGCCACCGTCCAGACCCGCTCAATGTGACGCCAGTC
ATGTGACGCGTCGTtcgccttgagctgctgctccacaaaCGCTGCTGTGCGCTGCACCAATCTAGACGTGGCCATCTGGTATCGTTTAATACTGGAAGTG
TGCCACTGGTTCGAAGCAGATTGAAAAGTGTTGTGGTGACTCACGTGGTTGGTAGGTAGTTAGTCCATATGGACAATTCAAACCCGCCAATCTCAACTTC
ACGTACgcttttggcgccaaaat