Description :
From Genome Similarity Track
Location :
Scaffold_1004:811- 1833
Transcript NameFunction/comments
g16779.t1hypothetical protein

Sequence
1022 bases(100 bases per row)
GTACACTATATTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGACCTCGACGTAACCCTTGACATGGCC
ACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAG
TCTGGATAGGAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTG
TCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGACGCGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTC
CGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATACCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCC
CGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGCCCAGTCATACGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTT
CGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCT
CGCGGAATAGCTCCCGGTCGGATCTTCTCGTCATCATCTGGATCACCGACGGGTTGTCGATGAGCATGTCACGTGGAATCTTGATGTAGTCATTTCCCAG
ATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTATGTTCT
CTGTCAGACGCACCGTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACCACCTGGAGAAT
TTGCCTGGAATCTCCCTGAAAC