Description :
From Genome Similarity Track
Location :
Scaffold_65:81092- 82515
Transcript NameFunction/comments
Hyaar_Emoy2807510threonine synthase

Sequence
1423 bases(100 bases per row)
CCCCCACTTCCTCTCATTCCCTCACTATGGTCCACTTCTGCAGCACCCGAGGCGGCGTCCGAGGCCTCAGTTTCGAGCAGGCCGTGCTCACGGGTCTTGC
ATCCGACCGCGGTCTCCTCGTACCCGAAGTCGGCGAGTTCCCGACGCTGCCAGCCAATGCGCTCGACCTGTGGCAGTCGCTCTCGTACCAGTCATTGGCT
GTCAAAGTCATGAGTCTCTTTATTGACGAATCAGAAGTCTCCTGTTCCGAGCTCCACGCACTCGTGAATAAGAGTTACAATCCAACAACCTTCCGGGCAC
CTGATGTCGCGCCTATAGTTAAAATCACGGACCAATTGCTCGTGCTCGAGCTCTTCCATGGTCCCACGTTTGCATTTAAGGACATTGCGCTGCAGTTCCT
GGGCAACCTCTTTGACTTTTTCCTCCAGCGCAGAAACAAGACGCTGGCAGCTGGAGCTCCGAAGCACAAGATCACGGTTGTAGGCGCCACTTCCGGAGAT
ACGGGGAGTTCGGCTATTTACGGACTGCGGGGCAAGCCAAACATTGAGGTGTTTATCCTGTTTCCAGAGGGACGGGTGAGCGCTATTCAGCAGCGCCAAA
TGACGACCGTGCTGGACACGAACATTCACAATGTGACTGTGAAAGGCACGTTTGACGACTGTCAAGCTATTGTCAAGGATTTGTTCGCCGATGCTGAGTT
TAAAGCCGCGTACCGCTTGGGAGCAGTCAACTCGATCAACTTTGCACGCATCTTGGCACAGATTGTGTACTACGTCTGGGCCTACTTTCGTGCCCGTGAA
CAAGGTGTGACGGGTGATGTTGCCTTCTCGGTTCCAACGGGGAATTTTGGGGATATCCTTGCTGGATTTTATGCCAAGAAACTCGGTGTCCCCATCGGCA
AGCTCATTGTGGCCACGAATGAGAACGACATTTTACACCGCTTCTTCTCCACGGGCAAGTATGATCGTCGCGATATTGAGCACACGATCTCGCCGTCGAT
GGACATTTGCGTGTCGAGCAACTTTGAACGCTACCTTTTTGCCTTAGCTGGCGAAGACCACGATGTCTTGCGCGGCTGGATGCAGGCTTTTGAGCAAACT
GGAGAGCTCACGATTACAGGCGAGTTGCTTGCGAAGGCCCAGGACGAAATGGCGTCGTACGCGGTGCTCCAGGAGGAGGTGCGCTCGACCATTGCCGAGT
ACAACAAGGCGCAGCACTATCTTTTTGACCCGCACAGTGCTATTGGCGCGGCTGCAGCCACTCGCTTCGGTTCGGATGCAGGTGCTAACAGGCCTGACTC
GGCAGTGGTCGTCGTTGGCACTGCTCACTATGGCAAGTTTCTGCCCGTTGTGTCTGAGGCGCTTGGTGTGGCCGAGTCGGAGATCCAGCAGCACCCGATT
TTGAAGGCCCTGGAATCTCTGCC