Description :
From Genome Similarity Track
Location :
Scaffold_111:81084- 82156
Sequence
1072 bases(100 bases per row)
GTGTTTCTCCGTTGCCCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACCACAAAATCCGTTCAACATGAACATTTTGGACGACGAAGGCGACG
ACGCCCTTCACGGCACCCGTGAAAGTTACTCCTATTTGAGCGATGTCGAATGGAGTGCTGTCGAACGAATGTGTTCGACTGTCGGCGAAGAAGCTGTCTG
ATCTCTGCTCTCCTTAAGGGATAGGTACCAACATCATTACATAGTCGCCAAGTTCTTGCAGCGAGAACCTGACACGTCGCAAGCCGAAGTGACTCTACTG
CGTCAGCACGGTCACCAGCAGACTGAGCTCCTGAGATAGCAACAGTCTCAGTCTGCTACTGCAGTGTCGACAAGTGAGCGTCGACGTGAGGCTCAAAAGT
TGGAAGTTTCCAAGTACTGGAGAGTCGAGGAAGACTCCTTGTTGAGATGGCTCCTCGAAGTGGACGATGCCGTTAAGGCTCGCCACATCGACGATCAGGA
AATGCAAGTTCAATTTGCCAAATCGAATTTGTCCCAGGGCGTGCCAGAACTTAGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGG
CGGTCTTTAAGACTCTGCTTAACCAAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGAGCTTCTGAAGATAAAACAAGGTAAGCGTGACAT
TCACGCTTACGCTCAGAACGTTCGTTACCTTGAAAGTTGCATGGTAGCGAACCCTGTAATTGAATTTGTGTTGATCACGATATTCTTACAGGGCCTCATA
GATGGTCCCGTAAGGAACCACCTATTCCGCATCGAGTTGAAGTAGCTTGAGAGAGCGAGTACAACTGCGGTGCAAGAGGACTTTAGCATGAGGCAGGCTC
ACATTAGCTTGACCCCCTATTGTCCTTCGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATGTTGAGAGCGACAGACCTCGCTTTTC
AAACAACAAGCGATTGCAAAATTGCAATCGCTGGCAGAAGTTAGGACACTACGCTTACGAGTGTAGTGCCCC