Description :
From Genome Similarity Track
Location :
Scaffold_191:81072- 82210
Transcript NameFunction/comments
Phyci_563446Protein FAM49A

Sequence
1138 bases(100 bases per row)
GCCATCGCTGAACCGCAAGAATAGCGTAGTTGATTCATCCATCGTTCACCGTTCTTCGCCTCGCGCTCGAGTGCAGTTAGTCGTTTCATGAGCGCTATAC
ATAAACCCCCAACGGAAGTCAGGTAGGCTGGGGCGAGATTCTTCTCCGCTCGCTCGTCCGTGCAGGATCCCGCGCGAACAGTGCGAGTGTCTCGCAGAAC
CGCTCCATCCTTCCGTTGTGCCGATCGCTGGAAATCGACAGCGAGGATGCCGCGGATGTTCAACTTCTCGCTGCGCCACAGCAGCGACAAAAGCTTCTCC
GGTACGATCAGTTGTGCTGGCAATTTACTCGTGCCCCTGCTGTCCTGTGGTCCTGAACTCTGCTGTTGGGCGCGCAGAGGCCATTATCGACCAAATGTGC
CAAGACCTCGCTGCAGAATCGGACGATATTATCGGCCAGGCAAAGAACGCGCTAGCACGAATGCAGTGCTACGAGGGGTGCCTGCTCCTCATCCAAAAAG
TGGGGGCTTAGTAGCTTAAGTCGATCGTTGGGTCTGCTCCTTGGGACTCACATCTTCAATGTCTACTCAGACTATTCGCGACCCAAATAACGAGGACCTC
AAGGCGGAGCTTATCACGAGATTAGCCCCGAACATCGCCATGATCCGAGCTCTATACGATCTTGCCATCGATATCGGTACTACGAGCGCATCCCCCACGA
ATAATGTCCATGATAGTCTAATTGCTTTGTTGTTTTGCCCGCGCAGAGACAATCTTTGCGGCGCTAGTCCAGATCTCCAGTCAGAAATGTGCGCTGCAAC
TTGTCTTTGCCTCGGAAGCACATTTTACACGCTTACAATTATTTTGTATTCCGCCCAGCAACCAAGAAGGCGGCAGGTTTCCTGATGGAAAAGATCGCGA
GTCTGGTAGAATTCGCCGTGAGCTTCGACGGTCTCAAGACGAAGACGCCAGATATCCAGAATGACCTCAGCCATTTTAGGCGGTTTATAGCAGTAAACGC
AGCGATTTCGAACCAACTCGAGAGGTATGCCACGCTAAGCAGATGCTGCTTGCCCATCGGCGGCTATGAATCTCACTGTGGAGACGTTTTGTCCATTGTA
GTCTCACCGATGCCCCACTCAACGCGATGTCATTTTTT