Description :
From Genome Similarity Track
Location :
Scaffold_545:8107- 9954
Transcript NameFunction/comments
Albla_Nc14136650
Albla_Nc14136640

Sequence
1847 bases(100 bases per row)
AGTTGCCCCAGTAGCCAGTACAGCCCGTAGAATTTCGACGACAGGATTGTTGCATGGATAAATTTCGCGGCCATCGACATGTTATCACAAAAAATCAGCA
TCAGATTGGGGATCATGACCGTCATCATGCGGAACAATGCTTTGACGCCTTCGGGAAGCCCTTATCGATCCAGGATTCATGGTGATAAAAGCGCCGACTG
TCGGATCCAAGTTGATACAATCTTCTTCCAACAATAAGACCTCGTCGTCTGCTTTACACGCATCACAAACAGCTTTGGATTGCACGGAACACACCCATAG
AACTTCCGGATTAACTTCATCAAACCATCTCACCGATCGTGACATAGCAAGGCTTTTAAATAAATTTCGCATACTTCTGTAATTCATCTCCGGTACACAA
AGTCGTAGGGCGTTCCAGCATCTCATATGAGGATTTGAATTCTTTCATCATGACGGCCGCTGAAAGCTTTTTCACGCTTGAGAAAGCTATTCTGAGCCGG
GGAGAAATGATGCTCTAATCGAGATTGCCACTGAAAGCTGTTTGGGTCTTCCACTCCAGCAAGAAGGATTATCTGAGCTGCATCCATTACCTTCCCGGTA
GAGTCTTCTGATTGATCCAGGCCACACGTGACATCTTTCTACAAGACTATTGAGATCGTGCAATGTGCTGTGAAAGCGTGCTCCACATGGCGGGTAAAAT
CACATTCAGGGACATCTTCGCTTTGCCTTCAAGCTTGAGCGGTTCTACAAAGTCTACAACTTCCAGGTCAACTCCAGCCACAATTTCGTGGATACTGGAC
GTTGAGTGTCAAGGTCTGATTTTGTACTTGACTGCTTCACATTGCATGTTTGCTAGGCTTCCCACACGATAACCCGGACTGATGTGTCGATTTTTACAAA
GTCTAGCGTAAGCTGTGGCGGCTTCGTCGGACTGAAAGAAGAGAGGCTCCAGATAATTCTAGTTACGCTGGATATTGCTCAACATCGCCACAACTTCATT
GACGAAGAAGAGGCCAATCTGAAGATCGGTCACTGAAGCTTAAAACTCAGGGTGGATAGGACGAGGCGCTCATAGTCTTCGCGTCGATCTGGTGAGTCAC
GAAATGCTCAGAGTTTTTCTCTTAGATCTCAAGCAAAGGTACGATACTTCCAAGTTTTTCGCCATTGATTGTGCTCCTTCTCCATCAGCTCCAGACTCAT
TGGTAGCTATGCGATGAAAGAAGTCATTTCCCAGTTCAGTTCATACAAACGGAGCTCCGATTCTTGTTCGTTTTCTGCTATTTCGCAAATCTCGGTGATT
TCTGAAGTGAAGCGATAGGAATTCCGAGTCAAAAGCACACCCAAATGCTATGTCGGATTCTTCTTCGGCGTAGTTAACGTCCCTTTCTGTGCCATGATGC
CTCTCCAGTGGCGGTTTTGTGCAAAATCGCCAGTAGAGACCAAATCAAAGGGTGCGTTTTTTCGAAAGCCTGACACTCGAGCACGATGATCGTAGACGTC
ACGTACCACTAGACATCCTTTGGAGTTTTTAAGGTCTTTCAGCATTCTTTGATTCTCTATTTGAGGCTGATTCACACTGACCTACTAGAAGCCCATCTCA
TGCGCTTACTCAATAAATACTCTCGCGAGTTTAACGTTGGGACGATGGGACGATGGACCTTACTTTAGCGAATGCTTCGACATCCAAGAGCATGTTTTGC
ATCCAAGCGATGAATTCTTCTATGATGTGAGCGAATCCGAACATGTGAAAGGTCTTTTTTTTTCTTCGCACTCTTCCATGTCGTTCTTCCAGTCCGATAT
GTACTGCTGAATCTACTCAAAAGCTTTGTCTGGCTCCAATTCTTCGA