Description :
From Genome Similarity Track
Location :
Scaffold_94:81064- 86640
Transcript NameFunction/comments
Physo_158281hypothetical protein

Sequence
5576 bases(100 bases per row)
CTGCAGCAGTGCAAAACTTCAGCTCCGTGCAAATCGCCTTAGCGCTCATACCCTTGGTAACTGAGTCGATAACGAAGTCAAACTCTTTCACGTACACGTG
GCACGGATTGTCCGAGTCGAGCATATCGCAGATCATGTCCGCATACGCGCGAATCTGGCGGATGTTCGCACCGTATTGCTGGAGCGCAATTTTGGCCACA
GTAGTGGCGAATTGGCAGTAGGAACACTGCGTAGCATTTCCAGGCGGCCATTGCGAAGCCACGACCACGCCCTTCATCTCATCAGCGATGGAAAGCGCAC
CCTCCTGCCAGCCTTCCGTTTTGTTGCAGACGCCAAGCGACTTGCAGATTTCATGAGGGCGCTTGCCCTCCTTCTCCATTTCCACAATCTTGTCGAAGTT
CTTGTCGACAACATCGCACTTACAGTCAGACGGAACCAGTTGGCACACGTTGGTCAGGATCTTCTTCACGATCGGCAGCTTTTCGGGGGACGTGTGGTTA
ACATGGTGAATAACAATGGCCACGCGCGAGCAGAAGAAGCAACTGCCGTGGGGGTGTGGGTGGGGAGGATGCGGAGGGTGTTCACCACCATGCATCATGT
CTATTCTGCCATGACGACCGTGACGGCCGTGATGTCCCCCGGGTCCCATCATACCCACGCGGTGGTGCATTCCAAGAGGTCCGTTTCGCATCATACCCAC
ACGAGGGCTTTCATCCAATTGTGGGGGTGCGTCCAAACTTTCGGCAGAGCAATAGTTCAGCGCCTTGCAAATGTCACGAGGGTGCACGCCCTTCTTCAGC
GAATCAATCACAGTATCCAACTGGTTGACATACACGTGGCAGGGACTGTCATCGCCCAGCATACCACAGATCATGTCAGCGTAGTCGCGAATCTGGTCAA
TCTGCTCGGGGGCCTCTTGCATGATAACCTCCACAACAGTCGTGGCAGCATCGCAGTAGACGCACGTTTTGTCGTCACCGAGCATTTCGGATGGGGGCAT
TCCATGGCGAGGCTTCATGGGGCAGAACTCCATGCTTCCACAGATCTCGTGGGGATGCTGACCCTGCTGAGCCAGCTGAACAATGCGATCGAAGTTGGCT
TCCACTTCTTGGCATTTAGCCTCCGGCGACGCCATTTGGCACACATTCCCCAGCACAGCCTTCAGCGCCGGAAGCTGCTCCGGGAAAAGGTTGTTCACTT
GGTAGATGACTCCAGCCACACGAGTGCAGAAGAAGCACGACTGGTCGTCCTCAAAGAAGTCAGGGGTGACCAGAGCTCCGTCTTCAACCGTCTCGAGCTC
TTCAGGAGTCGCAGACGCGTCTTCAATCTGGCTGGCGCTGCCGCTGTCCGACGAGCACATAGCAACCTGTGCACACACCACCAGCGGATCCGTACCGTGC
TTCAGCCAGTCCACGATGGCGTCGTAGTTCTTGAGGAACGTGTGGCACATGGAGTCCGCCGCCATGGCGTCGCACAGGTCCCCGATGATGGCTCGGACCT
GCTCCACCTGCTGCACCTCCTGCTCCAGCGCTTGGTCCACCATCTGCACGAACCTCTGGCACAACTTGCACGACAAGTTGTCCGTCCCCTCCAAGTCCGA
GACCGCCGACATGGCGTCGCACACCTCGTCGTCCGTCTTGCCCTCCTGCAGGAACTTCTTCACCACGTCCTCCGCCTTCAGCACCACGTTGCACTGCCAC
ACAGAGAACACCAATCAACACCAATCAGCATCTCCCCCCTCCTCTCCACTCCAACCACAGTATTAAATGCCCTCTCACCTGCTCGATGAGCTCCGGGCGG
CCGAGATCTTCGCACGAGGACTCGCTCCAGAGCTGCAGCGAGACCGTGCCGAAGGCCGAGCGGAAGTACTGCATCAGCGTCTCCGCCTGCTGCTGCAGCG
CGTCCTGCTCGTGGATCTTCTCCAGCGCCTTCAAGCACGCGCGCTTCCTCTCCAGCGCCGGGTCCTCCGGCTCCTCCTCTTCAATCAGCACGATGCGCAC
AGTGGCGTCTTCCGCCTCCTGGGGCGCCCCCAGGCTGAAGAAGCGCTGCAGCATCTCGCTCGAGCGCTGGAAGTGCTCGTTCAGTGCCGCCATGAGGCCG
GCCGCTCCATCATCGTCACGCTCGTGGTCGCAGGGCATGGCGGCGTTCGGTGCCCGCATGCCGTGGCGCATGCCGCGCTCGGCGCTCGCGACGGCCGCCA
GGCTCAGCAGCAGCGGCAGCGCGCGCATCTTTCCTCGTCCTTCTCCTCCTTCTTCAAGCTGGGCGAATCCTTGTTTGAAGGCACCTGCGTGTGACTCCAA
GGAAGAGGACGGATGGCACGGCTCGGGATGTTGTGCGCATTCCCCTGTGTTTGACTGACTCTTACTGAAAGAAAGTATAAAGGGGATGGTCGGGTGTACC
AGCTGTACCAGTCTGACGTTGCATGATGGCTCGGTATCAGGTGGAAGAAGGGGGGTCGCCTCTAATGAGTTCGTCGCGGAAGGAATGCTGGTACTAGTTG
AAGTGACGGGTCAATCAGATTCGTTGCACTGCAACAGATCCTTGCTTGATCAAAGTCCGAGTATTGATTCTCTATTTCTATCTCTATCTCTATTGGGGCT
GGACCCTCAACAGCCTAGCCCCTCCATTCTAAGGTTATTTAACTCACATCGAGCATCGCCGTGAGCTGCAAGCTGCCGCTTTGGGTAGATCGAGGCACCC
ACAGCACCAACGAACCTCCTCCCGTGCCTGGAAGGCCAAGAAATCCAGGACGCCATCGGTCAAGATACAGCGTCTTGCCTCCTAGTGCAGTCCCGTTTGA
TCTCCACGTAACAGTCTCCCCAGCCGGGACCTTCACCTCATCGATCTTGTAGCCGCCAGACTTGATGTTCACCCTCACATCCTCCGTGTCCACACTCTTG
AACGTGATGGTGATGGAGTCATCGCCACTCTTGGTCCAGCTGCCGCTGCTGTTCTTGAATGCCTTTCCGACCGTCTTCAGACCGAGCGCGTCCTTCGCAC
TGCCGTCGTCGATTTCTCCAGTGAACTTAGTAGGGCCGCAAATGGTCTGGAAGTACTCGGACACGACTCCGACGATGTTTGTCAGGTCCCAAGCCGCGTA
GAACGTCAGCGCCTTGTCCGCGATCTTGTAAGCGTAACTCTCAGCTGAAAGAAGGGTCCCGTTGTGGCTGGTACCCGACCGAATCAAGTCGTCCATGATA
CCCCCGAAGCTCTTGCGCAGCGTGTCCCGTGTCTGATAAGCCGATTTCTCGTCCGATTCCGAGACGAGCTCCTCCATGCAGTTGTTGGTCACGGTGGGGA
TCTCGTTGAGGACGAGGTCCGACTGGCTCATGGCCACGCGAATGTCGGCCTCAGAGATGTCTGGGTCTTGCTTGCGTAGGTTGGCTACACTCATCCAGGT
GCGGTCTAGCAAGCGCTTCATGTTGTATCCGCACGTTGAGTTGGACTCGAGCGCAGACTGAAGTGAAGAGATATCGTCTTGGTCCAACGATTTCATCGGC
TTGTCCAGTGTCACCTTCTTCATGAATGCCATGAATGTGGCCCAGCTGCCCACAATCCCGTCGGTATTCGTCACGATTTCCTTGACAAACAGCTCGACCG
TGTTGGTGATTCTGTCGGTTGTCCTGATGCTCTCCGACACGTGGATGCCCAAGCACATGCAGATCGTGATCGGGAGGTCAAAGACCACGTTGTCGGTTTG
GTACAGAACTGTTTCCAGATACTTCTCTGTCGTGTGCGGATTGGACACTTTGATCGTGCGGACGAACTTGGCCAGCTGCTTCACCAGATTCATCGTCTCC
TTGCCGCATTTGAAGGCAGTACGCACAGCATGCGCCATCAACTTGAACTCACCGTACAAACCGAAGGTGGCGAGGGACAGCCCCGAAAAGGCGATGACCG
AGACCTTCGACACGACTTCAAGCGCGCAGTCGTCGTTCTGCCGGATGCACTCCATGTCACACCTGACGGGGTATGCCAGCGGACATTCGGCCCAGCAAAT
GTTGTGACGGTTGTCGTACTCGAGAGGACATGTCTTGGCAATGTGGGCTTCGCGGTAACACGCTGTGTCGGGGGCACTGCCGAGGAAAGGACCTACCCAA
TTGGTGTACGTAGATTTGATCGTAGAAATGGTGTTGCCACTGGTAGACCCCGACCCAACGACTGACCCGTCGTCTGTGCTGTCAATGGAATCATCGCTGT
CGAGGCTTGCATCGCCATCGCCACTGTCGTGGACACTCATACTGTCATCGCTTTCTGAGGATCCGTTGTCGTTACTGGAGGACTCGGTGAAGTGGGTGGT
TGTTACCGCAATAGGATGCAGAAGAGCTGGCTGGGTGGAGTTTCTGGTGCCATCGAAGGTGTATGTCTGCGCGTTCGAACTTGCGATGCTTGAACTCAGC
AGAAGAAGAACTTGGAGCAGCCGATGCATTGTGGTTGACGGGATTGGGCGACGCGTCTCGTAGTAGAAGCTTTCCTATCGAGGAAGGCCCGAAAATGAAA
AGTGAGGATACTGTACATCCTTCCTTCTTGGTCGCAAAGGTTTGCTGCAATGAGGCAGAACCTCTAGTCTACTCGCTGTTCGTAAAACAACCTCACCACA
GCGGAAACTACCAGTTGCCATTCAGGTTTGTTTTAAGCTTACCAGAATCTGTATCTCGCAAAGCTGTTTGGATTGGCCGATATAGTACATAGTGTATGCC
TGAATAATCCAGCGAACGTGGACCAGCTCACGCGCGCCGTGTCTCCTGAAAGTTCGACTTCGTCGTCGATTCCGGTGCAGAGCCCAACCTGCAAGATAGT
TCCCTTGGATCCTTTGTCAGATCATCTTCGCTTGGTTGTACGACTAGCAGACTCTAGGACTGTACCAAGGGGATACCAATGGGCCCAAAGCAGTCGCATC
GAGGTACGACACGCCACAGCGAAGGCCGGACAGCGATTACTTGCCACCGGCACTTTGACACTTTGTGGGTGCGCGTTCAATCATCGACTCAATGTGCAAA
AAGACGCAAAGTTCAGGATTGATAATTCAGATGTGTTAACATCGGTTGCTAGTCGCTCCGTCGCTGTGCCCGTCTCATGCGGCGAGCAGGGACCATAGCG
AGCAGCGTCACTCGCAGGTGAGACTTGTTGAAATCACGTTTGATGGTTAGTGGGCGGTGGCATCGTATATGGAATAGTTGTTGCTAAAAACACCATTGAT
ATCGTCTTTTAGTCGTTTCTACAGTACCAATTTGCCTGCAAGTCAGCGGGAAGGAGATTAGAACTTGATTACAATCTCCAGACCCTACCGCTGTGTCGTT
CAGTTTTGGTAGGGGAGACAACTGAGACGCGTCCGCAGAGCCTGTCTTTCGCCAGCTAAAGCTGCGCGCGAGGTGTAAAGACGTTATTTCGCGAGAAAAC
TGCGCCAACAGAGTGCAAATGACGAGGAAGTGATCACAAATTTAGTTCGTAGGGGGATGTGCAAGCAATTAATGAGCGCGAACAACGCCACGTTTGTGCG
TCTCATCGATGCCGGACAATGTGCTCGCCGCGCGTACAGGCCGCCGGATGGAGGATTCCCACCCTCGAGTAGACGA