Description :
From Genome Similarity Track
Location :
Scaffold_39:81061- 83990
Sequence
2929 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAAAAGGGGTCATTACACTGCACGTATCAACCCCGACCGTGTATGACATCAAATCTA
TTCGTCCGGAAAAGCAACCCTGCTGCCTACGTGGTTTCAACACCAATCGTAGCGAGCACGAATCACATTGGCAATCATAGGCACAAGCAGCAGTACCGAG
CTTGGATGCTACTCCATTTGTTTGAGGTGCGAAAAGGGGTCATTACACTGCACCTGCCAAACCCCGACCTGTTGACATTGAATGTATTCGTCCGGAAACG
CAACCCGGCTGCTGACGTCGTTTCCGCCCCAATTGTAGCAAGAACGTATTACATAGACGATCATAGGTACGAGCAGCAGGGACGAGCTTTTGCCGCTACT
CCGCTTGTTTATGGCGCGAAAAGGGGTCATTACACTGCACGTATCGACCACGACCTGTTGACATTGAATGTATTCGTCCGGAAACGCAACCCTGCCGCCT
ACGTGGTTTCGGCCCCAATCGTATCAAGAACGTATAACATAGACGATCATAGCCACAGCAGCAGGGACGAGCTTTTGCCGCTAATCCGCTTGTTTAAGGC
GCGAAAAGGGGTCATTACACTGCACGTATCGACCCGGACCTGATGACATCAAATCTATTCGTCCGGAAAAGCAACCCTGCTGCCTACATGGTTTCAAAAC
CAATCGTAGCAAGCACGAATCACATTGGCAATCATAGGCACAAGCAGCAGTACCGAGCTTGGATGCTCCTCCCTTTTTTTGGAGGTGGGAAAAGGGGTCA
TTACAAAAGACCCCTGCCAAACCCCGACCTGTTGACATTGAATGTATTTGTCCGGAAACGCAACCCCGCTGCTGAAGTCGGTTCCGGCCCCAATTGTAGC
AAGAACGTATCACATAGACGATCATAGGCACAAGCAGCAGGGACGAGCTTTTGCCGCTACTCCGCTTGTTTAAGGCGCGAAAAGGGGTCATTACACTGCA
TCTATCAACCCCGACCTGATGACATCTAATCTACCCGCTCAAAAAAAGCAACCCGGCTGCTGACGTCGTTTCGGCCCCAATTGTAGCAAGCGCGTATCAC
GTAGACGATCATACGCACTAGCAGCAGGGTCGAGCGTTTGCCGCTACCCCGCTTTTTTAGGCGCGAAAAGGGGTCATTTACACTGCACGTATCAACCCCG
ACCTGATGACATCAAATCTATTCGTCCGGAAAAGCAACCCTGCTGCCTACGTGGTTTCAACACCAATCGTAGCAAGCACGAATCACATTGGCAATCATAG
GCACAAGCAGCAGTACCGAGCTTGGATGCTACTCCATTTGTTTGAGGTGCGAAAAGGGGTCATTACACTGCACCTGCCAAACCCCGACCTGTTGACATTG
AATGTATTCGTCCGGAAACGCAACCCGGCTGCTGACGTCGTTTCAGCCCCAATTGTAGCAAGAACGTATTACATAGACGATCATAGGCACAAGCAGCAGA
AACGAGCTTTTGCCGCTACTCCGCTTGTTTAAGGCGCGAAAAGGGGTCATTACACTGCACGGATCGACCCGGACCTGATGACATCAAATCTATCCGCTCA
AAAAAAGCAACCCTGCTGCCTACGTGGATTCGGCCCCAATTATAGCAAGAACAAATCACGTAGACGATCATAGGCACAAGCAGCAGGGTCGAGGGTTTGC
CGCTACTCCGCTTGTTTAAGGCGCGAAAAGGGGTCATTACACTGCACGTATCAACCCCGACCTGATGACATCGAATCTATCCGCTCAGAAAAGGCACCCC
TGCTGCCTACGTGGTTTCGGCCCCAATTGTAGCGAGACGAATTCAAGTAGACGATCATAGGCACACGCAGCAGGCTCGAGTGTTTGCCGCTACTCCGCTG
TGTTAAGGCGCAAAAAGGGGTCATTACACTGCACGTATCAACCCCGACCTGATGACATCGAATCTATTCGTCCGGAAAAGGCAACCCTGCTGCCTACGTG
GTTTCGGCCCCAATCGTAGCAAGCACGCATCGCATTGGCAATCATAGGCACAAGCAGCAGTACCGAGCTTGGATGCTACTCCATTTGTTTGAGGTGCGAA
AAGGGGTCATTACACGGCACCTATCAACCCCGACCTGGTGACATTGAATGTATTCGTCCGGAAACGCAACCCGGCTGGTGACGTCGTTTCGGCCCCAATT
GTAGCAAGAACGTATTACATAGACGATCATAGGTACGAGCAGCAGGGACGAGCTTTTGCCGCTACTCCGCTTGTTTATGGCGCGAAAAGGGGTCATTACA
CTGCACGTATCGACCACGACCTGTTGACATTGAATGTATTCGTCCGGAAAAGCAACCCTGCCGCCTACGTGGTTTCCGCCCCCATTGTAGCAAGAACGTA
TAACATAGACGATCATAGGCACAAGCAGCAGGGACGAGCTTTTGCCGCTAATCCGCTTGTTTTAGGCGCGAAAAGGGGTCATTACACTGCACGGATCGAC
CCGGACCTGATGACATCAAATCTATTCGCTCAGAAAAAGCAACCCCTGCTGCCTACGTGGATTCGGGCCCCAATTGTAGCAAGGAACAAATCATGTAGAC
GATCATAGGCACAAGGCAGCAGGGTCGGAGAGTGTTGCGGTTACTCCGCTTTGTTTAGAGGCGGAAAAAGGGGGCCTATACACTGGGCAGGTATACAACC
GCGACCTGGTGGACATTTAAATTCTTATTCGTCCCGAAAAAACGCACCCCCTGCGGCCTAACTTGGTTTCTAGCCCCAATCGGTAGCAAGCGACTAATAG
ACATTTGGCACATCAAAGGGCACAAGCGAGCAGTGCTCGAGCGTTTGTGGCCGATATCCCCTTGTTGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN