Description :
From Genome Similarity Track
Location :
Scaffold_171:81031- 85027
Transcript NameFunction/comments
Phyci_247084hypothetical protein
Phyci_97540hypothetical protein

Sequence
3996 bases(100 bases per row)
TTCTAAGCACTTAGCACCAGATGTGTGCGCGCGAGGGTGTCAGAATAATTCTGTTGACGTATTATGTCAACATGATACAGTAAGTGAGGCTCGTCCAAGC
CCAGATTATCGTTAGCGGTCAAAAACTTAGGAAAAGAAGAACGACGAGGCAGATTCAAGTATATAGCCCACAAGTAGCATACCGTTCTACAGTACTCTGC
ACAATTAAAAGAACGCTTCACTCCCCTGTCGACAACGACATCTCGCAACTATAATCCCCGCTTGCAGTTGAGCCTGTATCGTTATTCATGTAGTTGACGC
CTCGTTTCGCGGATAACATTTTCACCCGCGCGACATCGATGGCGCTCATGCTAGTCACTAAACTCATGCAGGCGGTGCAGAATGTCACCTTACGCCTTGA
AAGCATCAAGTCCGGGTCCACAAAACTCAGCTTTTGCACCACTTTACAGGAATGACACACGTGACCGAAACATAGCTTACAAGAGCTGTTGCTTTTACCA
AAGTCACCGAGCCGACGGCCTGTAACAGAAGTGCCAcacgtcacacagacgctcttctcgttgggtgtgccatgcagtttggactgtgagtaggctttgt
ccagcatgaatgaaagcttgcgcatttggccgcagtttgcgtacttggcgctagacaagaaggcggaggccatcccaggcaccaccagcatacggatcat
atcaccgcagggatcgaaaacaccggtggcatagatctccatcgtgttcggcccagcttgacgccaaaagccggtgatggacacgttgccacgaattcgg
ttcgggagttcgtgcgtctgtgggaagctcactgagtggaggagatggtagccgagtcgctcaccgctctcagctttgacaaatccagtgccctccgcgt
agacatagtcacggtttttcacaaggctggtcgacgcaaacggaatatcgagctccatccacttgatgatgagggactggaaagggtcttccagagtcgg
cagcacgattgggtctagcaccgcagcgccactgacatcgtcgacgtacgaggccttcaaccgcatcgtctcaagatcttcgcttatgacgccgtacatc
aagtcttccaacttgccTTCCATGGTTCCGACGCACAAAATCATGGGGAGGCCAGAACCTGTGAGGTCATTTATGCCAGAGGATGGGACGCTCTCAGGTC
GCTCAGCGTAGACCGTGAGTCTCTCTCTTGTCTTGATCTTCTTCCAGCGACGAGGATTGACTTTCCGCTTGCTCAACGATACAAAGTTGTTATACTTCTG
AAGGTTGGACATGATGAGATCGTTCGCTAGATCCTGCAGTCGCAGTCGATCATCGGGCTGGATCTGCATCTCCGGGAACGGGTTCACGATGAAGCGTTCC
TTGCCCATAGCGGCTCCAAGATTCTTATTAAACGCTTGCTGAGGATCCGAGCGCGAAAACCGAAGTGAAGTGTTATTATAGAGTGACGACCAGGTTACCG
GCCTCTGCCACTTTGTGGATGAGCAGGTACCCAAGAAGTAAGTTAGCACTCGGTTTGTTTTGAACTTCGCGTCCCAGCGGCTAGGACTAGCAAGATAAGA
CCAACGGCGTATATCATATGCGGTGTATGTTGCACGAAATATCTGGTTCAGGTTAATCACCAGCTGCGGTGTCTTGCAAGTTGCAAGTTGCAAGTTGCAA
CGCGCTAGTCGTCCTACTAGCGTTCGAGAGCCTCGCAACATGCGAGGCTCTCAAATGTACTACTCAGTATTGAAAGCAACGTCAGTTATTCAATGCCATA
TTTCACTCTTTTACGAGAAAAAATATTTACTACAAAAAGATACCATCAACCTTGCTAGTGCATAGACCTTACCGCGTCTAAGACGAGCTGCTGTATGAAA
TTTCGCTGCCGAAGTCGCCGCTCACAGTCGAGTTGGTCTGTATGTTCGAGTAGTCAATACCCTTCCTCACGCTCAGCATCTTGGCACGCGCGCAATCGCC
CGCACTCATGTTTGTCACTGAGCCGATGCATCCCGTGCAAAATGTCACTTTACGCTTGGACAGCTGCAAGTCGGGGTCCACAAAGCTCAGCTTCCGAACA
ATCCTGCACGCGTGGCAGACGTGGCCGAAGCACAACTTGCACGTGCTGTTGCTTTTGGAGAAGTCACCCAAGCGCCGACCGATTGGAGACGAAcacgtga
cgcagacgctctttttgttcggcgctccgcgctgttttgactcagcataagccttgtcgagcatgaatgtcagcttacgcatctggccgcagaacgcgta
cttcacgctcgacaggaaggctgtggccattcctgggactacgagcatgcggatcatatctccacacggatcaaagatgccggtggcgtacatttccatg
acgttgggaccggcttggtgccaatagccgataatggatacgttgccacgaattcggtttggcagttcgtgcgtctgtgggaagttaacggagtggagca
agtggtaaccaagacgctcgccattctgagaggtgacgaagccggtgccttcgagatagacgtagtcgcgattcttgacgaggctggtcgatgcgaacgg
gatgtcgagctccatccattttacgaggagagactgaaaaggttcttcgagggaggggagaactatgggatccaaaacggccgctccactgacatcgtcg
acgtaggaggccttgactcgcattgtctccaggtcttcactcatgactccatacatgtgatcttccagcttgccCTCGAGTGACCCCACACAGAGGATCA
TTGGAAGACCCGAGCCCGATGGCTCATCACCAGCATTATGAGCCGACTCCGGTCGCTCCGCGTAAACGGTGAGATGTTCTCGCTCCTTGATCTGCTTCCA
GCGACGTGGATCCACCTTGCGCTTGCCCGACGTGACGAACGTGTTGTAGTTAGCGAGGTTGGTCATAATGATTCCGTTGGCAAGGTCTTCCAGTTGCAGT
CGGTCGTCTTGAGAGATGCGCATTTCCGGGAAAGGATTCACGATAAAACGTTCCTTCACCATGATGACGGACTCCAGACTGTGGACACAGCGGCGTTGGC
AGGAAACGTGCTTAAATCAGAATGAGCTTCGTGGCGTTGCAAGCGGTTTTTGGGTCCAAGCGAGACTGCTTCTTGATTGCTTAAAACTCGCGCGTATCAG
ATCAGTCCGCAGGCCGTTGGGATAAGACACCGATGCGAAAGTCGCCGCAACGACCGCTTCTGATCGGACACACTATTACATAAATTTCACCACATTTCAT
TGCGATCAACTTTGTCCACTACAATCGATGTTTATTTTTCGCGTAGCCGTATCAAACATCTGACTTTTAAACCTCGCTGCAATAATTCCCGCTGGAATTG
GTCTGCATGCCCGAGTAATTCACACCGTTCTTTACGGATAATATCTTCTTGCGTGAACAGTCTACTGCGTCCAGGTCCGATACGGACGTAATGCACGTCG
AGCAGGACCTACCACAGCAGCAAGTCTGGATTTACAACGCTCAACCTACGTACAAGTTTGCAGCCATGGCATACGTGACCGAAAAACAACTTGGGGGTGA
AATCCCTCAAACGGCGAAAGTAGTTTACGCAGACGTCTTCTAGGAGTtccgtgtaggccctgtcaagcatgaacgagagtttgcacatttggccgcaatt
ggagtacttcactctggacaagaaagcaaaaaactattccaggcaccaccagccttcagatcataccccctcacggaccaaaggcgccagaccagacgcg
tttatttccatcacattgctgtctccaaaacgtgataagccttaattaattgaggcgttctcacgaattcagttcggaagttcgtgtgcctgctggaagc
gcatggagtggagtaggtgataccgtagatgagccgctcgTTTTGAGCATCGAGCAATAACGAAGCTCGTGCCTTCGACGCACAAACACCCGGCTT