Description :
From Genome Similarity Track
Location :
Scaffold_285:8102- 10466
Transcript NameFunction/comments
Phyra_72360propionyl-CoA carboxylase

Sequence
2364 bases(100 bases per row)
TCTGCACGTCTGCTGGGTCGCGAGGTGCTGTCCGCACGCAGCGGCGCTTCGCTGCGGCGCCTGCAGCAGGCCGCGGCCCCGCGGGAGAAGCTTTTCGACA
AGATCCTCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCCAGAAGTTGGGCATCAAGACGGTGGCCGTGTACTCGGAGCCTGATGT
AGACTCGGTGGCCGTGCGCATGGCTGATGAGGCCGTGTGCGTGGGGCCCGCGGCCTCGGCCCAGAGCTACTTGAGCATCCCCAAGATCGTGGCGGCCGTC
CAGGCCACGGGCGCCCAGGCCGTGCACCCGGGCTACGGCTTCCTCTCGGAGAACAAGGACTTCTGCGAGGCGCTGGAAGCCATCGGCGTGGCTTTCATCG
GGCCTGGACACGCAGCCATCCAGGCCATGGGAGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCAGGCGTCAACACGATCCCGGGCTTCCTGGGCGA
GATCGATACGCCTGAGGAGGCGGTAAAAGTGGCCCAGGAGATTGGATATCCCGTCATGATCAAGGCCAGCGCTGGCGGAGGCGGCAAGGGCATGCGCGTG
GCTTACAACGACGACGAGGTGCGCATGGGCTACCGCCTATCCAAGGAAGAAGCAGCCAGCAGCTTCGGAGACGACCGCATGTTCCTCGAGAAGTTCATTG
AAGACCCGCGGCATATCGAGATCCAGCTCATTGCCGACTCGTTCGGTAATGTGGTCCCGCTGCCCGAGAGAGAGTGCTCGATCCAACGGCGCAACCAGAA
GGTGATCGAGGAGGCGCCCAGTGTGCTACTCGACCCGGAGACGAGAAGGGCCATGGGCAAGCAGGCGGCCATGCTGGCCAACAAGGTGGGCTATGTGAGC
GCCGGTACGGTCGAGTTCTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAACACCCCGTCACAGAACTCATTT
CTCACGTGGACCTAGTGGAGCAGATGATCCGTGTCGCTGCAGGTCACGAGCTGCCCAAGGAGTTGGTGGATGGACCTGTAAAGATCCACGGCTGGGCGAT
GGAGAGTCGCGTGTATGCCGAGGATCCACTGCGTGGTTTCCTGCCGTCTATCGGCCGGCTGCTTCAATATGACGAGCCCGTGCACCTCCCGGGTGTGCGC
GTGGACTCAGGTGTGAACGAAGGCAGCGATATCTCCATGTTCTACGACCCGATGATCTCAAAGCTCATTACGTACGGCAAGGACCGTTCGGAGTGTTTGG
AGCGCATGAAGATTGCGCTGGACAACTACGTTATTCGCGGCCCTGGCAACAACGTTGCGTTCCTGCAGGATGTCTACCGTCACCCTCGCTTCGTGAGCGG
TAAGATTACCACCAAGTTCATCGAAGAGGAGTACCCGGACGGCTTTGAAGGTGTGAAGCTGACAGCACCTGAGATTGAGGACCTACGGGTGGTTGGCGCC
ATCATGCACCTAAAGAAGGCTATTGCCAGCAGCCAAATCTCGGGCCGAATTCAGTCAACACCAACGGAAGGTTTTCCCTCCTTCGACTCGCTCAACAATG
ACGATTTGGAGTTTGTTTCTCATCAAGAGGGAGTTGTCCCGCGCCTGCGTGCTTTCACCCCTGGTCTATCATCGGCGGAGTTGATCGCGATTGCGGAGCG
AAACGACCTCAAGAGTCTCGGTGCTCAGCTGTCGGTTAGCATCGATGGACCATTTGGAGAAGCGAAGCCTGTCGTTGTTGTCGAAGTGGAGCTTGAAAAC
GCGCGGCACCGCATGGAAACGGCGACGCTCGCTTTTGTCGACAACAAGTGGCACGTTGTGGGCGATGTGGATTGGTCGCTGAACAGTCCGCTCTTCAAGG
CGTCATACGCAAAGCAGAACGGACCCAAAACTGCGCTGGCGTCGCAAATGCTGCAGACGCTGCCCGAGGGATTCCGTCTCCAATTTCACGGAGCAGTCCA
TGATGTCGTCGTACGCAACGAATTGGAGGCTGCGTACGGCATCCACATGAAGCCGAAACCCGAGGTCGACACGTCCAACTTGCTGCTATGCCCGATGCCC
GGCATGCTCATCTCAGTGGCTGTCGAGGTCGGCCAGCACGTGGAGCTTGGGCAGGAGCTAGCCGTCGTGGAGGCTATGAAGATGCAGAACGTGCTGCGCT
CTGAGAAGAGGGGCGTCATCAAAAGCATTGCGCATGCTGCTGGTGATTCACTCAAGGTTGACGAGATCATCCTCGAATACGAATAAGCGCTCTATGCTGC
GCTACAACTGGAAGGTCAACCTAGGCTAAGACGTAGCGGTGCACATGGAGATATGGAAAACAAA