Description :
From Genome Similarity Track
Location :
Scaffold_1994:810- 4676
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1994-fgenesh-gene-0.0Aminotransferase class I and II

Sequence
3866 bases(100 bases per row)
ACTGCAGTTGCCTCCTGCGTGCACGGTTTACGAGAAGGGGATCTCTCTGTGCGGAATGAGCAAGACCTATGCCATGCCCGGTGTGCGTGTCGGCTGGGTT
GCCAGCCAGCATGAGCCCTTTATGACCAAGTTTGCGACGCTCAAGGACTACACGACCATCTGCAATTCTGCACCGAGCGAGATCTTGGCGCTTATTGCCT
TGCGCAACAGAAGCACCATTGTCGAGCGAAGCCTGGCGATCATCCGTGCCAACCGAGGTCATGTGGAGAAGTTTATGGAAGCCCACCGTGACATCTTCGC
GTACGAAGCACCCATCGCCGGGCCCATCGCCTTCCCCAAGCTCATTGGTGGCGAACGCACTGACGCAGGTGTCTACGCGCAGCACTTGGTCGACAAGTAT
GGGATTCTCATTCTGCCGGGCGACAAGTACGATCAAAGCTACAACGACCGCTTCCGGCTCTCGCTTGCTCGAACGAACATGCCCGAGATTCTCGCCCTGT
GGGAAAAAGACTTTGCACCTACGACGGCGTAAGAGATGTGTGAGGAGGCAGGGAGACGAAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
TACATCTTCACAGTGAGCGCATACTCAATTTGTTGCTACGGCTTTCTCCTATGCGTCANNNNNNNNNNCATACATCTTCACAGTGGGCGCATACTCAACT
TGTTGGTACGGCTTTCTCCTATGCGTCATTGATTGGCTGAAATACTGAGCAGCATAGGGTTTCGCGTTTCCAATTGGCTACAATTCTAGTTGCAAGTGAG
GGTATCACCAAGAAGAGAAGAGATGGACCTGTGGCGGGATTCCGGTGACGATGTGGATGCGCGTCGGTTGGATGCGGTGCTTGCTGTGACGCTACTGTTT
GCCGTGGTCATCGTGCCCCCACTCATCGGCGTGCGCATGACGTACACACTGTGCTGGTTGCTGTTCACAGTGCTCGCGCTGGTCTCGGCTTCGGAAGCTG
CGCGAGGCATTGCGACTTCCATGGGCATAACCGTCATGGTCGGATGGTACGCGCTGCGCGTATATGACCGAAGTGCCTTTACGGCTGCCTTGCATGGCTG
GGTTGGTCTATGGGCGACCTCTCCTGTGGTTGGGTTCGTCGCGCGTGTGGGCGACTTCCTTGTGCATCTCTTGCTGCCGATGCTGCTGATCTCGTGCTTT
CTCCCACTTGTCCGTGTCTGGATGAGCCTCCCCGCACTCATGTACGTGGCCAAAACCGCACTATGGTTGGAAGAGGGCTTATGTCGTGATGTACTCCGAA
ACATAGGGCGTCTCGGTTGTGGGTGCATTTCGTCGTGGGCGGTGGGGTCGTGCCAAAAGGGGACCACATTTTTCGCTTCAGCCCGCCGCGGTCGCAGCAT
TTTTGGAACGCTGCGTACCGCATCGAGTTGCTTCTCGATTCGTGTGTCCCGCTCTTTTGCGTCTTAGCACATCAGGTATATCATACGTCGTTGATCTCAC
TTGTTCCTCCGAGAAGACTAAGGCTTGGTGTACTCCAGCGCTCGTTCTGGGTCTACGCCGTGACAGCCTTCTGTGGTGTGCTGCTCATTGGCCTGCACCT
CATTCGATCTTATTCACTGAGGAAGCTCCGCCGAAATGCCAAGGAGATCATGTCGAGGCTACTCGCTGGCGGAGGGCTCCACATCTCGACGGTTCGTGTT
GCCCACACCTGCATGTGGTCGCCGACAATCTGACCAATTGTTTCCTTGTTTTGCAAGGACTTNNNNNNNNNNACGGGTTCGTGTTGCCCACACCTGTATG
TGGTCGCGACAATCTGACCAGTTATTTCCTTGTTTTGCAAGGACTTTATTGTGCGAGATGATGCGATTTGGCTGGATTGGATGCGCGACGGACTGGTTGC
AATCGGAGAAACGTACGTCGGCGGTCTCTGGGAAGCAGCGGCAGGCCGGACGCTGGACGAAATCGTGACGGCCCTCATGACGATCCCTATGGAAGCCCGC
CAGGAGATGTATCGTTCGTGGTCCGCCCGCCTTGTTGCCTTGGCAGCTCGAATGTTCAACTACCCCACGGCGTCCAGGGGTCTTGTCGTGGGCTCTGCAG
TTGAGCAATTCGATTTGTCCCCACAGTTTCGGCGCCAGTACATGGATCCGTACCTTCACCAGGGGTTCGGCATCTGGATTAACGACGCGAGATCGTTGGA
AGGTGCGATGCAAAACAAACTCGAGGATATTCTTGAGAAGCTGGACCTGCAGGTAATTCATTTTGTCCGTGTCGAAACTGGTTTGCTGCCAGTGCTGACT
CGGTTCGTGGCATGCAGGACGACCAGCGCGTTCTGGATTTGTGTCTGGGGTCGATGGGAGGAGTTGGCGTATATCTGGCCGAGCAGCGAGCCCACGTGAG
CGTCGTGTGTGTCCTAACGTCAGTCTCCGAACGTGTCCACGCTATGCGGTTTGCGGACGAGAAAGGAGTCTCCGACCGAGTTGAAATCATTGTCGCAGAT
TCACCCGACAAGGTTTGCAACGGCGTCGTTACTGAGAGCGTTCTTGTTTTGAAACTCACTCAATCGTGTGATTTGCAGCTTCTCACTGTCCTCAGTTCCA
TGAGTGCCTCGCGTTTCGAGCGGATCGTAGGCAGTGGTCTTGTGGAGTCGCTCCGTCCATTGCAACTGCCTCGTCTCTTCCGAACCATCAAACGTATTCA
GACAGCAGGAGGCCAGACGTTGTTCGACTTTGTTGCCTGCACAGCGTCGAGATCCACGACTCACGTGTGGAACAACCAGTACATCAACGGCGCGTTCGCC
GTGCAGGCCTTGACGCTCCATCGCGTTCGTGACCTCCTCGATCTGAGCGGCTTTACCGTGCACGAGATCGCCAGTTACAATGAGCACTACGAGCGCACGT
TTGTTGAGTGGTATCGACACTTCCAGGCACGCTGGGGCAACGCGAACGACCTGCGCAACCGCACAGTCAGCGACGGACCCGGCCGCCGACCGCGTGCTCC
GCCTGCAATGCAAGGCTCCTCGAATGTGACATTGGATCAAAGCGCCACTGAGACTCTTGCGCTGCAGCGCGCTCGCCAGTCGCTGCCCGAGTCGTTCCGC
CGCACGTGGGAGTTTTACTTGCTGCACTCAGCGGCGTGCTATCGCGCCCACGTGCTGCAGGCATATCAACTGCGCGTGGCATGACCATGGATTTCCCCAT
AGCATGTCACAGATGCTTGAAGTAGCGGTAAAGTTGCTTATATCGATTTTATGTTGTTTATCAAATGTTATGTTGCAGCAGGCTCTGACCCACCACAGCT
CGAAAAGGTTCTGGAACACGAAGCGCTCAATAATGGCAACGACGGGCGCCTCGGAATGGGAGAAGCACGTCGACGACGAGACGCAGACGCCCTACTACCA
CAACATCCGCACGGGCGAGACGTCGTGGGAGGAGCCAGAGGGCTTTGTGGAAGCTTCCCCGGACGAGTCAGCCACGGCGACCGCCAAGCCACCACGGTGG
CGCCGCTACATCGACGACAGCAACGGCAAGCCCTACTACTACGATGAAGCAAACGATGTTACGCAATGGGAGGAGCCAGAGGGCGACATTAAAGACGCAT
CAGGTGAGACCCGGTGGGTGTCAAAGGGAGCTACTCTAGACTGAATCTCGCTGAGCGATGTGCCGAAATGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCAGATGATGAGAGC
GAAGCCGGCGAACCTGAAACGACAACGGAGAGCGACAAGAAAGTGCCGACACCAACATGCAACTGG