Description :
From Genome Similarity Track
Location :
Scaffold_3855:810- 2318
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3855-snap-gene-0.1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1508 bases(100 bases per row)
AAAACGTTGGGTGGAGCAGCACGGCGAAGGCGATCGTGATGTGCAGCTGCATGCAGAGATACGCGAGCACGACCATGCCCTTGTCTGATGCGAAACCCAG
CTTGGTGAGGCCCGTGGTCTCGTCCGGGAGGATCGTGAAGAGCAGGTTGCCCGAGATCTGGCAGCCAACAGCCGAGTAGCCCGTGATGGCCAGCACCAGG
AAGAGCACTGAGATGAGCGTGAGCGTGACGCCTACGATGCGTGGCATGCGTGCGGGGTCGCTGTGCTGGCGCTGAAGTGCTGGGATGACGATACCAGCAC
CGTACGCGAGTGAGAGGTTGCCGAAGGTCGTGGCCACCTGCTTGAACGAGATGTCGGGTGTTGGGATGGCCGTGTGACCACTCATGCCGTGCAGGAGCAC
TGCGACGCCGATGACGTCGGCGATGAGCGTTCCCAGGCAGCCAGCAAGTGCAGCACCAGCTCCTTCCTTCATGGTCGGCGTCAAGATGACTGGCAGCACA
GACACGGCCATGAGGATGATCCATGTCGGCTGGTCAAACGCGCCTGAGAACAAACTGTCGAGCAGGATGCCGCCGAGAACGAGAAAGGCGCATGGGACGA
GTAGACAGACGCCCATCTGGGAGATCAGCACCAGAAAGCGCCCAGGCTTGCCCATGCACCACTCACCCAGGTCGCCAAAGGTCTTGACACTCTTGGGGGC
CGCGAGCAGCACCTTGGAGCACACGACGGAGGCGTAGACATTGGAAAACGCCATGAAGAGCAGCGCGAGCGTGGCGAGGACGGGACCGGCACGGGAGAAG
TTGGCGGGCATGCCGAGTGTTCCGATGCCGTAGACGCAGCAGAAGAGGTTGAAGGCGATCTTGGCATCTTCGAGCGTGAACCAGGCTTTCGAGCCCATGG
CGGACGGCTGCAGTAGGTTCTGGCTGGAAAGAGGAGCCAGGCGTGCGGAGGAGAGTGGAAGTCCGATAGTGAGGGCTTCGCATGAGGGCGACATGAGTGA
ATAGAAGGCGCGAGGTAGAGAGAGCGAAAGGAGAGAGTGGTGATGCGTGACAAACAAGCTAAACCTGAAGGAGCACCACACTCAAACAACTGGTTTTGCC
CATCACAAGTTTCGAGATGGCACATTAAATGGTATTTTGAGCCAAAATGACACTATCGTTTCTATTGTCTAACAACAAAAGTAGGAGGAGATTATTTAGT
TGGGACAAATAATTCCATTTTAGTAGACAGTTTGGATCCTGAACTTCAAGATCCTGCACTGCAAAGCTCAGTGCAAAGAATGAGCTCTGCAAAAGTGACG
TGCGGTCACAACATATTGGCACGTGAAGGAGTGGGTGGCAGTCCTGTACCGGCAGGCAATCCCAGCAGAATACTCAGCAAGAACCGACATGACGGCGATC
AAGACTGCCAAATAGCAACCAATGTAACAGCGAGCACTCTCAAGCCAGCACCTAATACTTCGGACCTTGCGCATTCTGAAGCAAGCCTCGCCAGCAAATT
AAACAAAT