Description :
From Genome Similarity Track
Location :
Scaffold_150:81- 7169
Transcript NameFunction/comments
Hyaar_Emoy2811206PREDICTED: uncharacterized protein LOC101265908
Hyaar_Emoy2811207phosphatidylinositol-specific phospholipase C
Hyaar_Emoy2811208hypothetical protein

Sequence
7088 bases(100 bases per row)
GAAGTAAATAGTGTATACCTGTACAGCAAGGCTCTACACTCGTCTTGGTCATCGAGGCTCCCGAAATTGTTCCCCTTCATCGTCCAGCCGAGTGAAAAAG
TAGGGTGGCACGGAAACTTCCTCTCCTACTATTCGTTCCGCACATTGAATGGACGTGTATGCGATGTGGTCGATTCTTGGTAGATGTATAGGAAAGGTAG
CGAAGTAGTGTCAATGTATGTCTGAACACACTTAGCACACACATGTGATTCTTCTTGCGCCGCTGTAAACGTACGGTCGATAACAGCTAATAACAGATGA
ACAGATGTGAAGCTCAGCAGCAGTAAGTGACTGCTATGATTGACACCGAAAAAGTTGTCAGCGGAAAACATTCTTGAGCTACAAATGTTGAGCCTTGCGC
TTCTCCTTTCATTGTCTTGAAAAACGCAGTACACTCGCTTGTTGAGGTTATCATTGCACTTACGCTTACCGCTAAATCACATAGAGAATTGCTGTGCACA
TCTCTGAAGTCTAATTCTACGAAAACATGGCTGGCACTCTCCTGGTCCAAGTCATATTGCATAGCCAAACGCCGTTTTACCCTAACAGGCTGGCGGATTC
TTCAAACATACGGAGGGAAGCACGCCAATGGATCGTCCAGCTTGTACCGAGCGTCTTTGATCTTCTACAGAGTTGGCGCATCGTAGGCTCGTTCACCTCT
CTTACGGTAGTCACCATTCCATCAACTAAGCAAGCAAGATGGCCGACCTGAAACCGTGCCAAAAGGAGAGTGATATGCACTAGTAGCACGGGAAAAGAGC
GCACCACGATCGGCGTATCCTTGCATCAAATTTTCATCTCGTCCAGCTTACATGCATGTGTTCACGACCTACACGTATGTGGTCCGATACCATTTATCGC
TACTAGTAGATCATAGCGGCAGTTGTATCTACAAGGTCCGACCGGATGTTCGGATGATAAGGCGCTGGAAATGCGAGACGAGTCGCTTGCGAATAATTTG
AATCAGCTGCTTCAGCTTCGAGTATACAAGACGATGCGTCAGCGAAGCTACAGAACGGACCGTCATAACGGAAAGTCAAGTACAGATGGTCATTCGATGC
TCTGTCTGTAACCGAGCGAAAAGCCTGTATTGTCATGATGTCGCATCTCAACGTGTACTATTTGAGTGTCATTCTATCTCGACTTGGCAGTATGCACTTG
CGGCGCCCCATCCTTTCCGAGTGCACATACTCAATGGGATCCGTCCGCACGTGATCCGTCCGCACTGAAGTCCTGCAATCTCCATGTCCGGTCTATATGT
TCGTTGTGGTGGTGGTTCAAATCGTCTTTTTTATTGTTATAGTACCTATGTGCAAGGTCTCTGGTATATCGTAAGCCATGCCGTGATCGCCGGAGGATGA
TCCGGGGGCCGACCGTGACTGGGGCCAGTAAATACTGGCACCCCTGTAGGTTCGCGCTCCAGTAACTCAATACATGCTTAGAGCGTGCCCGAAGTTGAAG
TTGTGGTCGCTACTCTTCGATGCTCTCGCTTTGTGATCGCACGGAGGTGATAGATGCAGGTGGCCCAATAACTGTTTGGCATATCGTGGCAAGGATGTGC
CAGATTCGCTTTCAGACACGTTCGGCCTCCACCACATCATCTTGGAACCTTTCCTTCACGAGACCTGCCTAGTGTTTCGGAATAACTTGTACTTGTCTGC
CAGCGCATGCTTCCAGGAATTGTTGAGTGCGCTGGCGGGACTCTCGTTTCCCAGACCAATAGGTAACTAGTTTGGTCCATAGAGCTACGGCGCATGGACA
TACCCAAAACAATTGTTCCATGGTCTCTTCGCGACCGCGGCAAGCTAATATCGTTCGACAACTTTTTTCCTCGGTCCTCCCAGCGTGATACAGGTGAGCA
GGCCCAACGCGACCCTGTAACCTGTCTAAACTTGATACTCAGAGATGCCATTATCATTGTATCAAACTTGCGCCTCGAAGATGAGACCCCATTTCCGAAT
AGCGGTAATCACTGTCCGACAGATGTCAAGTTGTGGAATTGATCCCTCCACGAACCAGTGTAGCCCGTCTTGACCTTGAAGCATCGCCACGGAAAAGGAA
ACGTCCTGTGTGCAGCCCGTTGCTATACCTTCAATAATACTGGTGGCTCGAAGATTCCAATGATAGCTCGACTTGAACGGTGGAGCGTGCCGTAGTACCA
GTGGCGGTCTCGTGTTGAATGCTGCCCCTATGGGTAAGTCGGGAGATGATAGCAGAAGGGCTGTCGCCATCGCCGTAATTTTGCAGCTGTGTGGCGCCAA
GATTGATCCGCTGGCCGGGGTATCTGCATTTCAAATTCCGACGGACCTGTGCGCGCTATGTGTAGCGCTGCTAGTGTACATTCCTTGATTGTGGTGTACC
TGCTGATCGCAAGCATGTTACCTCTGCGATCACGTCCATGGGTTCGCACTCCAGTTAAACGTGGTCCAAAACCGGTGTATGACGCCCGGCATGTCGTCAA
CACCTAGTGGGCGTCGTGGAAAGGTGATGTGATACGAAATCACAAACTCGTCGTCTTCCCACCAGCTGGATGCCCCCGCAAGCAACTCCTCCCAGTGCCT
GTTGACCCAAGTAGTGGTTTGGCGAAGTTGCTCTGGTAATGGCGCAATCCATTCACCAAGCTCTTGCCGCAACAGATGACCGTGTCGACGGCGCCGTTGA
GGTGGATTTCGCCGTGGAACATGAATTGGAGTCACGATAGCTGCGTCCCCCTCTGCGTCGCCACGAAAAGTCCAGACCTGCCTTCACGATGAGTAGTGGT
CTTGTTTTTGAGCAAACCAAGTAATCGCATGTTTAATTCGTTGTGTTTTGATAGCCACTGATACGTGGGCGAGGCCGATGCCTCCCGCATGCTTCGAGTC
ACAAAAAGCCCTGGGTTTACTTTGTGACGACTTCTTTCTGTTGTCGTCGCATGCGCCCACAAAAACTGCTTGTATAAATTGTGCATCTCCAGCTCCACCC
AATGCGGTATGTCAAACACTATGGCGGTGAAAAATATGGACGGTAGCACGATAGAGTTAAGGATTAACACGCAATTCATCGCACTCAATGCTACTCGTGT
CGCTGTGAGCAGGCGCCGCTGGATACGCCGGATGCGTAATGCCCAATTTTTGTTTACGAGCTCCCCTGTCCCGATCTCGTGGCCCGGGTACCTTGTCGTT
GTTCCAGGAGGGACTACAGCAATACCCTCGTACTGTTTAATCGCAATGGCTCAGTTTAAAAAGATTAGCTGACTATTGGCCGGTTGGACATGGAGTCCAG
ATAAATCCCCGAAGGCTCGAATGATCGTTAGAGCACGGGGAACTTGCTCAGCTATTTCAAGGAACAGAGTTGAGTCATCGACAAACGCTTAAAAAGAGGT
GAGTCATTCCCGGGAGACCTGGCGCTGATAATCCCGTACGACGTGTATCCTGGTGTAGTGCCAGGCCTAACATCTCCACGACCAGCAAAAATAAAGAGAG
GCGTTAGAGGACATCCTTGCCGAATACCGGACCTCACCGGGAGTGGTGTTGAATGGTTCCCATTAATGTGACGGGGTTCACAAATTGTTGTGATAACCAG
GTACATTGGTGTGGTACACAGAAAGAGACCAGCATCACTGATAAGGCATACTTTTGTATCACATACGCTAAGCTATAAGACGGTACCCTATCGGTTATGA
TTAGAGGATATCTATCGTAATAGGGTCTTCATAGAGGCGACGTAGTTCTGGTGTGGTACACGGGAAGAACTACGATGAGGATTATTCGATTAGGTAGCAT
AGTTTTAAGGTTAAAGACGTAAGTAAGGTTTATTATCGCTATAAATCAGTAAATATATTCAGTTCCCCTTCTGATCAGTTTTAGACACGTGTCTTTCTAA
GACGTCTCTGGTCGTAAAAGTTAAGTGCCTGAGTTAAGTCTAAGTACTCTTGGGCATTAGTGCCACGTGATTCCTTGGAGTCTTAGTCCCCTGAACCAGG
AATAGAAGCTTAAGAGCTTGTACATACACTTAGAGTTGAGTCTCACTAAGTATGTAAGACTTGAGACCCTTTAAGTTAATACCCGTTTAGTTTGATATAC
TAACAGACTCTACGAGTCTAGAAGTCCTCTGACTGAGGAGTTAGGGTAGCTCCGCTACTTGGTAGCGCTTGTAGTCAATCTACACCTGAGTCTGCTAAAG
ACTGTTCCTCTGTAAGGATGGAAACAAAGATAAACCTCTCTGAGGCCCAAGGATTAGCGCTAGAGAAACCCAGAGCGCTAGTCGGGAACGAACGAGTGGA
TTTAATCCTCGCACAAGGTCCTGACGTGATCCGTGCACGTCTTGGCGCTTTTATGCAGTTTGAGCCCACTTTGATTGGACAAGTACACGACCATTTGGCA
TCGGTTATGACTACTCAGTTTGTTCATGTACCTGATAAAGAGCCAAGGGCTCGCCCCCTTGTCTTGACTTTAAAGACAGTTGAGGGAACAGAAGGGGAGA
ATCTACTCCTGTGGATCAGGGAGGGGGAAATGGCCATGAACTCCGCTATGCTCTAGTCGGAGCAACAGCGAGTTGGGATGGCTATCCCAAAACTGGGTAG
TAGAGCCAGAGAATGGGCTCTCACGTGTAGTACGTCGGTAGACGAAGCTTTCCCCACATGGGATTTGCGAAAACAGCAAATGTCCCAGGAGTTTGCTCTG
CCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCTGTCAGGTCAAGAAAGAAATATCGGACTATGTTCAGGAACTGATAACTCTCATCGCTG
CCATGCAGCTTGATCCTTACCAGAAATGGTTCTGGTTATCATCTTCATAGAGAGCCTTCGTACGGGCGTGGCTCGAACGGAAGTATTCCGGGTACACCCC
ACCTCCTTTGAGTCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAAAGCAGCCCGTTTTGGCACACATGGGTACAAACCAAACTCGGCGAACT
CCTTTAGTTCTATTAATAGTCTGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAATCATATCGTCAAGCTGTAGAACACCATCGAATCATTCG
ACGATGTTTCACGTGCGGAAGCACAAAGCATCTGCGACCTAATTGACCTTTACGCAGGGCACGTCAGAATACTTCAGACCGAACCCCCGCCGCTAACCAG
AAGTCTGGTACGGTGCGAGAAAACGTAGACTCCTAAAAGGCGCGGGGAGCCCTTCGGGGGAAGAACTAGATTCTATTAACCCTATAGGAATTAGTGGCGA
GCAGAATTTAATCCCAAGGAGTGCCGTGCACTTTAATGCAGGACGTGAATACAAGCAAGGCTTATTGTTCGCAAAGGCGACTGCTAAGGGCTTTGAAAAC
CCTGGTCCGTTTTGATCGAATCCGGAGCATCCGTTAATTATGTCAGACGCTTTTCCCTTGAAGGGAGTCCACGTTATGTTGAGGCGCTAAAAGCGCACAA
GGGTTATACGATCACTGTTAGCTTGGCGACAGGAACTATTTTCACTGCACCCAAAGTTCCCGTGAACTTGGGTGTGAACTTTTTCGATTTTGATAGTATC
GAACGCTGTTTAGGCCTTGATTTGGTCTTGAGATATGATCTCATTCTTGATATGGCTTTGCTTAAGCGCCATGAGCCATGGGTCGACTGGAGGTCGAAAA
CATTAGGCGCCACGCGCACTGCCCCTAGCCGAGCTTTGGAGAGTCACGAACTCACCTCTGCTAGGAATCAGAAGCGTTATCGGCGCGAGCCACTGGCTGG
CAATGTTAGTGTGCTGGACATCTGAATGTCAGGGTTAGTTGATTCTGAAGATGTCAAAGACATGAGTATAGAGCATATGCCAACCCCGTAGGCCAGGATA
TGCTGCCACGTGTCGTCTCCCTGCTGAATGGATTTGTAACCCTTCCATATCAGGTGGTACACGTCGGATCGCGGTCCCCTGATCGCGGACCCCTTTGCGT
TCTCCTGATCGCGGTCGTTTGATTGCGGTCCGATGATCGTGGACCGATAATCGCGGACCCCTGGTCGCGGTCCCTTGATCGCGCCTATCTAACTCCATCG
TCTTTCCACATTCTGATACTGCGCTGATGGATGGATTTCTTTCCGCAGGGTTATCCAATGGTGACGTTAATATTAACGGCCATCGTCCCACAATTCGTCA
GCGACATACCGCTTCGTACTTGGCCAAAATCTGATATTTTATGCTCCCAATCGCGATCGGCTTTACCATAATCGCCCCCTACACAAATAGCTCTTCTGCA
ATATCTGGCTGGCTTGTGCACGTTTCAATATTCACTTTCCATGATCTTCTTCAGACTTTTAGTCATGTTCTCCCCATTCGCTTTACCACAGAAAACTAAC
AGCATTTGGAATGAAGTTCAGAATTAGCAGGATGTGTTTACGCCTTCAGCCTACCACCTTGGTTAATACTTTTGTGACACATCATGCAGCATTTCATTCC
TACAAGCGAGCTGTTCATACGCTCCGATAGCCCATATTTTGTGGGGGGTACGGCATATTTCGTTCGTACCGAACTCTTGATTCATTAAAGGAATATCTTA
AAAAGCTAAATCTACATATTTAGCTCCAATATCCTATTGAAACGTTTGATGCAAGCTCTCTGTTGTTTTCCAATAGCAGTTTTATAGTGTCGGAACTTCG
ATAACCTCTAAAAAAATTATGAACATAACCGCCACATGGCGAGAGAAATCATCGGCAAAATACTACTGCATATCTGCGTCTACCAGGAGTCACTGTTTGC
ATTGGACTCATATCATCAGAGCGTATCAGCACTAATAGCCCTGATGTTTCCACTTTGCTCGCTGGGTTTGGCGGAAAACTATCCTGTCGCATCTTGCTGA
GGCAATACCCGTCACAAATATCTTCAGTTGACATCTTATCGTCCATCATGGGACATGTTTTGGCAACTTTCTATAACTCCTTAAGACGTGCTAGCGAAAT
GTAACCCAAACTAGCACTAACCTTCTTCCATGCCGAATGGGCTCCTTCACTGAACGCTCAAATGGATTACATATCACTTCAATCTTGT