Description :
From Genome Similarity Track
Location :
Scaffold_1564:81- 5416
Sequence
5335 bases(100 bases per row)
CATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGT
CGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAG
GCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGTTGAGTCTTTCCTGGCCAGCCTTAAGGCTGGAG
AGATTGCTGAGATGGTGCTCTTGAGACCTGATACCACTTGAGAGGAGCGTAACTCCTCCTCTGTCTTGGACGAGAACGTCCTTAAAGACCTAAACAAGCA
GCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGCGACGGAGTATGCGGACGTGGTGAACAAACACCCACCG
ACCCAACTCCCACCGGATCGAGGAGTACGGCATGCGATTGATCTCGTGTCTGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGT
GCGAGGTCATTGATGCCATCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCC
GAACGGAAAGGGGCGTCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGCCTAAACACCAATTCCACGAAAGGATGTGTTGGTGAACAAC
ATGACCGGGAGCGTACTGTACCGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGATAAGCACTC
CAAGCGGCATACTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCG
TACCTTCGTACAGACGTACGTTGACGACATATTCGTCCATAACCGTGCCGAGGGAGGCAAGACGGCCATGAAGGTGCATCTGGGGCACCTCCGTCGAGGG
TTGGACGTAATGCGAGCAAACCAGCTCTAAGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGG
ACGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCT
TCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGCCTCCTTCGGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCT
TTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGGCGTCTGCGATGCCTCCGATTACGCCA
TCGGATGTGCATTGCTGCCGGCCGACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCTCCGAGAGGAACTACCATGTCCA
CGACAAGGGGCCCCCGGCAATGAAATATGTCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCAGGCCCTTCGTGATCTACACAGACCACGCATCCTTG
AGGACGGCGACTAACTCGCCACACCTCTCCCAAAGGATGACGAGGTTGCTGTCCGTTCTTCGTGAGTACAGCTTCCGCGTCGAATACAAGCCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGCATTGTCAGCAGGGTCCGCCATGCCAT
GGCATCGGCCTAGGATAGACAAAAGGAGTACTTCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAGGTGGGGGGGGGCTTAGTGTTACTAGACACA
AGGAATCTACCTCCTGACACTGTTATCTCTGTCGGCACCAACAAGCTAAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGT
ACACCATCGACCTGCCTAAGTCAATGACGACGCACCCGACGTTCTGTGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGGTGACTCGAAGAC
CCACCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAAGGCGTCGGAGCAGGCATTCAAGCCTCGGTCGGAACGGCAAGGCTGCGGT
CAAGACCGTACGACGGAGATGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTCGGA
GTGTGCAGCAGCCGGCTCCGGATGTGGCAGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATTCACC
CGCAGATGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCACTGATTCCCGGCCTGGGCGGCAGCATCACCGC
TAGTCCCAAGGCCCAAGTGCAATCTCAAGCATGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCGGTGTCGGATCCGCAGCCGGAGCACTCGGAC
GAGCGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGA
TCCTCCAGGAGGAACGGCGTCGCGGTAAGCGACAGATCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCT
GATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCAGCATCTTTATAAGTAGTCCGGGGCTTCTTGCCTGAACGGGGTACGGACGATGAAT
ACACTCCGTACCCGCGCGCGTCGTGAGCGCTGGAAGCCGCACGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACTAAGTGGGAAAAACGAGCACG
AAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCAGTGGGTGAGTACCTGAGAGACTCTACCCACGACCAGAGC
ATGTCCTCACAAGAACGCCAAGTGGGACAGCTCTCGGGCATAACCCAGTGGTATCCCCAAAGAGGATAGAGACCCCTCTTCCGGGTCTCGGGCTTCTTAC
GACAAGTCGTGAAGTCCTTCAGAGGGATGCGGTGTGGCGCGAGAAGCATACACCGAGCAGCCTACAAGTTGTCAACGAACAACTGTTCCTTCTGAACAAG
GGCAGTTCGCAAATGCCCCTAGAAGTGTGGCCGCCCACAAGGACACGAGGAGGGACGAGAAGCTCTAGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAG
GCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTG
GTCGAGGTCATTCGTGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCACTTCTTCCTCCTTCTTCTCCTTCTCTTCATCCGCGGAGTCGAAGATG
CCCCGATGGGAGTGCCGAGTCCCCTTCTCCTCGCGGAGTGGAGGCTTAGAGGCTGTACGCTTCTTTGAGAGCTTGGCGCCTTCGGCTTTAGAGGCCTTAT
CATGCGCAAGACCCTCGGCAAGCGAGATACGTTTGCGATGTTTCTCTTCCTCATCACTAGCAGCTTTGGGAGTGCCCTTGGCCTTGACGGCCGGACTCTC
AGAGCGCACAGACGTCCTGGGACTGTGATCACTTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGCACTGAGCTGTGCCCTTCC
GCAGAGCCCGTAGGAGCATCGTGCATGCTCTCGGACTCGGATTCGTCCTCACTGCCAGAGTTGAACTCACGTTCTACGAACCGAGGGCTCGGACGAGTGT
CTGGAGAGACCGAGGGCGACGGGCTGCGGCGCTTGCTTGTTCGCTTGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGC
CTCCTTAAGTGCCGAGCCTTTGCCGTGAGGCATAG