Description :
From Genome Similarity Track
Location :
Scaffold_1766:81- 2615
Sequence
2534 bases(100 bases per row)
AGGGCGTTATCGATCAGCGTTTGGTTGATTCTGGGGTGCGTTCTTCATTCCGAACGGCATCCGTTTCCACTCGAAACAGCCCAAACGGGGTGATGAATGC
GATTAGTGCGGGAGCTGATCCGTTCATAGTAACCCATCCAGAAAACCATGGCCCATGTGTAGAGAACAGTACCAGAGTTACTTTTATCCAGATTTTTCCA
AACAGGTTGTTGAATGAGGGGCATTCGAGATACACATCAATCGAGTCAGAGCGTTTAACCAGACCGGTAATCAATGCACAGACGTATATCCACCCCGTTC
TTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCC
GGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATT
ACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCA
ATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTT
GCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGGT
ATCAGGGAAACCACCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGCTGCCACTCTCGATAGGGATCCAGGC
ACTTTATCAAATGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTAT
CTAAGGGCTGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCTATTGCTTGGATCTCAACCCATCGATCCCTCTGCAGGATCTTTCGCGGAGTTGG
ATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGC
CATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTA
ATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAG
TCTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCT
CCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGA
AATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACTAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCT
CCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGTAAAGGCGGTATCTAGT
ATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACAACTTTCCTGGGGCATGGT
ACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGC
AGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACT
TCGGATCTGGCAAACTCATCCACTTGGCGCGAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGAGTCCTGC
TACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAAC
ATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGATTGGCTGGATCAAACCATTGGCGGATCCGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGT
CGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCAAGCATCCAGA
TTCAGTGGGCTTCCGGGATCCGCACTGTGAACAC