Description :
From Genome Similarity Track
Location :
scaffold_1916:81- 2360
Transcript NameFunction/comments
Pl_100242NA

Sequence
2279 bases(100 bases per row)
GACACTTTAGTCGTTTGCAAAACTCAGCCACGACTTGGTTTTTAAAGTGCGAACCATTATCACTAACCCATATTTGTGGTACACCGAAACGACTGTGCCA
CCCAAGTAGTGCTTCCACTGCTACCTCACTAGTTGGGGTATCGCAAGGTACTAATTCGCAAAAATGTGTGAAATTATCTTTGAGTACTAGCAGATATTTG
CAAGTATCAAATCCTTCGCCCAAATGTAGAAAATCCCAATTTAACGCTCCATTGCGAATGTCAGATCTATATAGTGCACCCCATGGCCTCGGGACTACCC
TGCCTCCTTTTACGTGCTGACATAACAAGCAGGAGCGCAGGAACCGACGCACAAATTTTGTCAATCCATCAATCGAAAATAAACGACGCATGTGGTTCAA
AACCACTGCTTCACCACGATGCCCTTGAGCCCCGCAATGGGCAATTACTAGGAGACGCTGAATGAGCGTTTTGGCCACAGTAGGAATCCATAGTGTGCTC
CCGACTCGGATCATCCCAGGTTCATCGCGGTCTCCTGTTGCCGGAGCTGATTTTATGTGTGCTGTCTGCACTGCCGCAATTTCAGTCAATGTTAGCCAAA
TAAATCCCTCTTGGTCAAGTGGTCGCAATACTGGTTGACGAGTGGTTCTCACTTGTGAACGTGTAACACGCTTGAAACTAGAAGCCGTAGTCGTAGTGAG
AGCAACAGGAGAACAACCACCCCACCTACTGATCATGTCCGCCCACAGGTTGTTAGTACCTTCGATGTGAACAATCGTGTACCGGAATTCCATAAGTTCT
ACAGCCCAACGAAGCAATTTCCCCCTAATATGCTTTTTCACCTCGTGTCCTGGTGCAAATACGTGAATAAGGTTTCGGTGGTCACAATACACTTTGAAAC
CACCGGGCCTCAATAGTAAATAATCCAGATCCTCACAGGACAAAATGATAGGAAAAGCTTCCTTTTCAATTATGCTCCAGTGTAGTTGAGCCCCACTAAA
TGATCCACCCTTGCAAATTAAGAGTTCGTGAGCCTGCCCCGTGATAGTGACGCCCTGCTTCCATTCAGCAACTTGTGTGACGATGGATGCCCATCCTGAG
TCACTGGCATCTACGAACAAGCAGTAGGTAGCATCCTCGCGTGGGTGTATCATCGTTGCTGCATGTTGTAAAAGGTTTTTACTTGTTCAAAGCTGTGTAC
TGCTTCAGGCTCAAAAGTAATGGACACTCCAGAAGCAACTCGCTTCGTTTTCCGCTTTCCTGTAAGTGCTTTGTCCAGTAGTAACTGGAGAGGGCGGATG
GTCCGTGCATAGTCAAGGAGACTGTCACGCATCCAGTTAGTTGCGCAGATGAATTGTTGTAATTGTCCAGCTGTGGTCGGTATCGGCATCGATAACAGAG
TATCAATTCGTTTGGGGTCATGACTGACACCATGCTCATCGATCACTTTACCACACCACGTGACTGACTTTTGATATAAGGAACTCTTCTTCAGACTCAA
CTTTAATCCGTACTTATTCACTAAATCAAATAGTTTTTCCAAAGCATTGAGATACTCAGGAATTGTGTCTGCAAAGAAGAGTAGATCATCAATCCATATG
AGCAAGTGCTCATGTAACAACTCTGTGAAACAATCTTCCATCGATACTTGAAAATGTAATGCAGAGTCACAACTACCTTGCATCACACGCGTTGGTGTAA
ACACACCTTCGTCCGTCATGTACGAAAGCATCTCTTGACTATCCAAATCTACAGCCAGTTGCCAAAAGCTTCGAATAAAATCGAAAAGACCATAGTGCTT
CTTACCTCGCAACCGTTCCAGTTTGGTTTTCAAATTAGGCATGACAACCTCCGTCATTTCATTCAGTGGTTTGTAATCAACAGCTTGACGAAAGTCATCT
ACTTTCGGTTTTCTGATAGGGAGGGCTGCACATGCCCAGCGACTGCTAGAGTTTTTGTAAACCCAACCCAACTCCACAAGCTTCTTGTTGAAATCTCTAA
GGAATGTGCTCTGGAGAGGAGCATACTGTCTAGCTTTGCATCGAAATGGTTTCGCACCTTTCTTTAGTCGAAGTTTATAAGGAGGAATCTTTGCAGGTGG
GTCATCGCGCAAAGTGAGGCGCCAAATGTCATGCTTCGAAGTAATTCGGCGAAGTTCATCAATTGATTCTCTAGGAAAACCATTCTGGAGAGCTGCATCC
AAAAGTTTCTCAAGATCTTCAGAGATATCTGCATCGGTAGCATGACCAGGATAAAATACATCGTCATCTCTATCGAAAG