Description :
From Genome Similarity Track
Location :
Scaffold_3790:81- 1580
Sequence
1499 bases(100 bases per row)
AAGGAGGAAGGCAACACAAAACCCTGCTACGAGATTTGGCACGAACTCTGGAACGACGGCAAGAGCATCCCGCCAGGGCTAAAAAGAAGATCAGGTTCCG
TAAGCGTAAGAGGGAGGAGAACTAAGTGAGAGGCAATACATTGTAGTAAAGTGTACTTATCTAAGTCGAGTGGTCGTGGTATCTGCAGGAAGAAATCGCC
CAAGCCCTCCTCACTAAGTCGTTGGTTAGGAGCTGGGCGATTTTTTTCCTCTTCGCGTGCGCGTCCGCGTGGCGCGCTTTGGTTTGGCGCCAAGCATGGC
TGGTTGGTGCGACGCTGCCCGCAGGAAAGATGATAGCATCGGAGTCGACGGGTTTTAAAGACCAGCAGGTTATGGCTGTGATTTACCTTGAACTCAGCCA
AAAGAAGATCGGGATTCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGAC
TTTCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAAAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAA
AGCTCCGACACCCACGGCCCCAGCTCGACGCGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATTAGGATCCGACAAGTCAGACTCCGACCCTGAA
GATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGT
ACAGATCCCGAGATCTCATGGACGGGACAGCACAAGGCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTAAATCTGGATGCTGGAGACATCTGGTCTG
TGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAA
TTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATATTAAACTAGGACGCTCGCCGGGTTT
GAATTCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAAT
ACACGTGATCTACATGAAATGTCAACTGTCCACAGAGGTCTCTCTATTTTTTTTTTGCCACGTCTCTAGTTTGACGACAAGTGGATATGTTTTCCAGATC
CGAAGTTTCTTCAACCCTGGATCTACAAAGAGGACCAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGT
CACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCTGTGGATACTG