Description :
From Genome Similarity Track
Location :
Scaffold_70:80981- 83428
Transcript NameFunction/comments
g6129.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
GTTTTGGAGTGCTGGACGTACACTTCAGGACTGCCACCAATCGACGTGTACATCGACCGCAAGCCATTCTATCGCTTGTTCCCGGCTTCGTACAAAATGA
AGATCAAGCGCAGTCTCAGCCCTGTTAACCTCCATTTGGGCGTAGTTGACGGCATCAAAATCAGCAAGTTGACTGCAGAGGCTGCGTTCTTCGTCAATCC
AAGTTACAGCGAAGGCTACGGTCACTACATCAACCAGGCGCGTGCTTCCGGGGGTGTCATTGTCACAACCGATTTGCCTCCGATGAACGAGTTGATCACT
GCGAATGAGACGGGTCTGCTGGTTCCGGTGACGCCGCAAAAGCACCCGATGGTGATGTTGGGCGGCAAGTACAAGGGGAGTTATGGCTTGAAGGGCGTTG
GTGGCCTCGTGGCCTCATTTGAAAGCTCCGATGTCTGCCACGTGATCAAAAATATGCTGCAGTCGACCACGCCCGATGACCGAGCGGCAATGGGCTTCAA
CGCTAAACGACAGTACCACGCAGACACAAAACACTTTGCTAGTGCAATGCAAGAAGTGCTAAGTTTTGCCAAGGGGGCGAGTCCCAGTGGATAAACGCGA
AATACTCACGATAGATAGAAGATTGGTACGCTCAGCGAGAAGTTGCTATATGGAAAAGGGATAAACTACATGTACGAACGCTCCTACAGCACTTCGAGCA
AAATGAATTGTTACACCTGCCATGGCGGACGCCTTCAACCCTTGGCTTAGCAATGATCGAGAAGAGAGGGAAGATTGTGAAAATTCCGGACACGTTCTAC
ATCACCATCCGATCGATTATCACGAAAATACTTGCCGCATCCACAATGCCTCAATCGATCGCCACTTCCCATTGAGCTCTTGTAGGACGCCACTCCCGGT
AGTCCTTCACCATGGATAAGTGGCAGCCTCCACAAGCCCGAAGCCTCAAGTTGCATCGCTTTTTTGTCGTTCTTCTGGTCGTGTGGGGCTTTATTCTCGT
CCTCGAGACGTCATCCCTGCTCGAAGTCTCGAAGGAGCGACTCACCAACAACTCACGCTTTCAGCGAGCTGTCCGTATCGGAGTTTCGTGGCTCCAGCGC
AATGAAAGTCAGAGGTCTGACAAAGTGCAGGGAATCCCAGAGCCTGCGGTTGATGCTGGTGACTCCAGTGAGGTGTCAGAGGAGGACTTGCTGCACTTAA
GCTTGCTGCATGAACGCTGTGTGATGGACACCAACGCAACGCTGCCATGGGAATTCGGCTCTCCAGGTTATCAACTGGCCAACGGATCGGCGAGCAACCC
TCAAGTTGTGATGCACCCGAGCGATACAGATCTACTACAGAAATTGCGGCAGTGTCCCGACGTGGATATTTTTCTTCCAGCAAGTCTGCATGGCAACGGA
TATTGTGAAGACGCAGTGGCCTACGCGAAGTGTGAGTGTGTGGTATGAGTTTACTACTGAGCGTTTGCATGGTGAAGCTGACGCTGTTGTAATTGACTCT
TGCTAGACTTGAATTCTCGGTTGTTGCCAGAATGGGCTCTCGAGATCAAGCTTTTCGATCCTGATCTCGGACGCGAGGTCGACTACTATGATCTGTGCCC
CAGGACGCCCATGCTATTCTTCAATCATTATTGGGAGGGCGTACCGTCGTCGCCGCGCTGGCCGAAGGGCAAACCCATCTATCTGATGCCCAACATTGAG
ATGTTTGAGCTTACGGCGGTTCACTATTGGAAGGTTGATGCCGTACTGTGCAAGACAAAGGATTGCTACGATCGAGTGACGCGTTGGTACGAGCAAGAGG
GCAATCGACGCAACACGGCCGTCTTCTACACGAAGCACACGTCTTCCGACCAGGCTCAATTCGCTCGCAAACGTTTGGGTGCAGACGCCATTAAACCTAA
GGACTTTTCAACCCTCAAGTTCATTCACACGGCTGGCACCAGCACCGGAAAAGGCACACGGGAGCTATTGCACTGCTGGGTACTTGTTCCGGATCTGCCA
CCGCTCGACGTGTACATCGCCAACGAGCCATTTGACCGCTTGTTCAAGCCTAATTTCAAAAGATTCCTGAAATTCAGTCGCAGTCCCCTCAACATCCACC
TGGGGTTGGTAGACCGCTCAGTGTTCACCAAGATGACTGCAGAGGCTGCATTCTTCATGTGCCCGAGTGTGAGTGAAGGCTACGGTCACTATATCAACCA
GGCCCGGGCAGCTGGCGCTGTCGTTGTTACCACCGACTTATCTCCGATGAACGAGCTCATTGTATCGAACGAGACTGGGTTCCTGATCCCTGTCGAGCGT
ATACAGCACCCGCGGGTGCTGCTGGGGGGAGGTTATATGGGCAAGCATGGTTTGGAAGGTGTGGATGGACTTGTGGCATTATTCAAAGGCCCCGACATTT
GTGAAGTGGTCAAGCAAATGGTTAAGTCTACAACGACTGAGCAACGA