Description :
From Genome Similarity Track
Location :
Scaffold_664:8097- 11477
Sequence
3380 bases(100 bases per row)
GGAGATTGGAGAGCTCGGATCCATGACGAGTGTACACTTGTAGTGAGGTGGATCAAAGTGACCTGGGTCCGGACAAGTGTACCCATAATGTGGCGACCAC
AATGATTACGCCAGGGATCCGGTGGATCTGATGATGATACAGCTGGATGATGGGTCAAAAAGAAAAAGGACATGCAGCCGAACCTGGTAGGGGATTTAGC
AGGTAAAAGGCATAGAAGGTAGAAATCCAGGGAAGTATAGGTTTAAATCAATACAGTCTTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAA
GAACCGGAGCTACATTGGCCGTACGAGCTCGGTGAAGGTTGGGAATCGCGAATCTAGTGTTGGTAGTGATAGCTGGATAATACATTGGCCAGATCCTACA
ACCTATTGAGCTTTTCCTTTACTGGTGCAGATCCGACAGGTTAACCGGATTTACTACTTGGCCGGCAACACCCTAGAGGTTCTCGACTCTCAAGATCCCG
TCACAGGAGGCGGCAAGTACGACGAAAAGGAAAAACAAATGAGCTTAGGCTCTAGTCGCTTGAAGCGACGGCGATCTGAACGAGGTTCAGATCCGACTTT
CGGCGGCAGCGGCGTCGTCGTCGACGGCGACCGTGACGTGAAACTTTGTTACCCACGTCTGGAGAGGTCGGAGCGCCGACATCCGAGGCAATCGAGACCT
CGTGTGGTACTGTGTTACCCACACAGGAAGCGTGGCCGACGCCTTCCTCTTCAGGTAAGGTCTGGGCGACCGCGTGTGGCACTATGTTACCCACACAGGA
AGCGTATCCGACGTCTTCTTCTTCAGTTAATGTCCGGGCGACCGTGTGTGGAACTCTGCTACCCACTCTGAACACGCTGTTCTCAGTGTTCGTGACAGCT
GCAGCTGTCTGCGGAACTAAGTTACCCGCTTGTGGACCTAAGTTACCCACTTGGCCAGCGCGTCTTCTGGGCGCTGCCACCTTCAAAACATCCTCGGAGT
CGTCATATACGTCGACGACTCCCAAGCATCTGCTGGTACCCTGGCAGCCCTTTCGGGCGCCCCGAGTCCTGACAGAGGTGGGAGCATGACTCACCAATGC
TCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCATCGCCAGTCGACCCGGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCA
TATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCCGTCAAAGTCTTCAAACTTGACGGCCGGATCCACTTGGACGTTGGGGATAGTGACGACCTTCC
CGTCGGCTAGTCGCACTGACACCGTCCCGCTTCCCTTGTTTTCTCTCAAAACATCGGACAACTTGTTGCTGCTGCGAGCAACCGTCTGGCGGCGTGCGAG
ATTTATCGACGCCCCAGAATCGATCAAGATTCTAAAGGGATGATCGTATCCCCGCACACGACCGTGTACTCCGAGCAACCCGCCGCTGCTCTTCGCCGAT
TCGAGAGTGCGAAGACTCTTAGGGGCTAAGGCCACGTGGTACGCGCCACCCGCGCACCCTTCACGAAGACATAGTTCTTCCCCAGTAGGGCGCCCCGCCC
CTACTGGTTTCCGGCGTTCCCCTGCCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAAGTCCGTCTGCGGAGTCTTTCCGCG
GGGCAGTCGCGCTTGAAGTGGTCCATCTTTCCGCAGCCGAAACAGCGAATGTCGCGCTGCTCGACGGACCCGAGCTCCATGGGATCTGGTCCGTTGGGGC
TCGCTCGACAGGGATTCGACAAAGAACTCCCAGGTCATGCTGAGGCCGGCGTACGCGCCTGGTGATGGCTGTATTCTTCCTGAAGAGCCACTTGAATCGC
CGCTTCAAGGGTGCTTGACTGCACCCAGAACAGCTGAGTGCGCGCTGGGCCCACTCAAAGGCCGTCCATGAGCACGGTCATCTTGATGTGTTCGTTAAGT
GGGTTTCCCATTAGGGACACCGTGATCTCCCGTATCTCTTGCACGTACTCGTGCAGTTCACGCCTCCCTTGTTTACACGAGAGGAAAGGTTGCAAGATGA
TGTTGGATGATTGGAGAGCTCGGATTCACGGCGAGTGTACCATTACAGCGAGGTGGATCCAAGCGACCTAGATCCGGATGAGTGTACCCATAACAGGGTG
ACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAAGGACATGCAGCCGAGCCTGGTAAGGGA
TTTAGCAGATGAAGGACATAGAAGATAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCCATTTGCACAGTATCACGCAAGTGCTTTCCC
GCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAGGGTTGGGAATTGCGAATCTAGTGCTGGTAGTGATAACTGGATAATACATTGGCCAG
ATCCTACAACCTAGTGAGCTTTTCCTTTACTGGTGCAGATCCGACAGGTTAATCGAATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCA
AGATCCGGTCACAGGAGGCGGCAAGTACATCGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGC
CCTGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAATCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCG
CCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGATAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAG
AACACGGATCATAGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGGGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACC
ACAATGGTGCGCGTGCCCGGACCATTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGT
CGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGA
TCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCAAACAAAACAGGGGAAA
GTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGGCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGA