Description :
From Genome Similarity Track
Location :
Scaffold_83:8095- 12856
Transcript NameFunction/comments
Hyaar_Emoy2808556hypothetical protein

Sequence
4761 bases(100 bases per row)
ATATAGATGTTAGAGGAGCTGGCCTTACTCGCATAACGAGTAAGGCCAGTCACCCTAACGTTCCGTGAAAAGTTGGCGGACCTGATCAAAACTTTATTAT
CGGCAAAAATTATATGTCCCTCAACTTCGCCATGGGCATCGCCGATCGTAGTGATCGTGAAAAAAATGGGGTGGATATACGACTGTGTATAGACTACCGA
AGAGTTAACCAATTGACGAGGCTGACGGTATATCCCATGCCCCTGATCAACGACTTATTGCAGGATCTGGACAAAGCGCAATGGTACTGTTCATTGGATA
TGGCCAGCGGATTCTGGATTGTGGGGATGACGGAAAGAGCACGAATGATCTCTGCTTATCACGCCCTCGGGTCTGTATGAATGGTTACGCATGCAGCTCG
GTCCGAAGGACGCACTGCAGATATATCAACATATGGTAGATAACGCGTTATATGGATATCGTATGATTGGGAATCGGCCGAAGTCAAGTGACCACGAGGA
GTCTCAATAGGTCGATGTGTTTACGGACGGCGAACCAAATCCGCACCGGAACCCTTCGGTTCTAGGACGAAGGTCCTACATTGATGACATTCTAATCCCA
GCGTCATCTTGGACGTCTCTCTATCGGAAATAGAAAGATTGTTGGAAGTGTGTGATCAGTGGAATTTGTCGATCAGCCTACTTAAGAACGTCCGCGGACG
AAACAAGGTTGAGTACCTCGGGAAACAAGTGTCAATAAAACGAATCGAAACTGGCCCGAAGGATCTGGGGTCGTTGGTGAATATTCCTTCTCCCCAGACA
CTGCGGTCAATGCAGCCCTTTCTAGGAAGCCTGAAATATTACAGCCGGTTCATTGAGGACTTCGCCATATACGTCTCGGTCGTGTACGAATTGAGGGAAG
ATGATTTTCATGAGATCAGGCGTTCGCAAAACACGGAAGTTGAAGGCTTACCCAGATATGATCGCGGCCATAATACCCAGATTGATGATGACAGCGGGCA
GCTACCAGCAGGTGATCACGATCATCCACTGGTGACAACGAGTGGTAAGGTTCCAATTAAAGTGAAAGAGTCCGATGGAGGACATACTGGTGCTCACCGT
TGGGAGAAGGCCATGATTGAGTTCAAAATGTTCAAGGCTAAAGTAGCCCAAACCCCGTTACTCAAACATTTTGATCCACACGACCGACCAGTGATCGTGA
TTTACGCTAGCAAATGGACGGTATCTGCAGCTTTGCTACAGGAACATGATGGAGTGAATTGGCCTGTTATGTTCACAAGTCGAACGTTAAAACCAAATGA
AGTTAATTATGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGCTCCGGATGTTGAATATTTGTTATACGCTATTCGTCTATCGGCGTGTCAAGGTTCTCACG
AGATATTCTACCTTGGCACGGTTGATGCAGTCGTCAGGTCTCAATGGACGACTTGGCAGATGGGCAGCTTTACTGTCGACTTGGACTTTGAAGATTAGTC
GATGTAACAAAGGGAAGGACGAAATCCTCGTCACCCTCGCAGCGAGTATTACACCGCGAGAAGATATGGATAAAATGTTGATCGCGATCGCACCACGGAA
GCAACCGAGACAGACTATCATTATGCCACCCCCTACGTTTAGAAGTGGCAAAGTGATTCTGGTCGTCATCTTTGACGGGTCAGCACGTATTAAGAAAAAG
GGGCGCGCCTACAGTGCAGTGATATGGAAATTACCCGAGTGGTCCATATTGTTGGCTGCGTCGCGTTGCGATACTGGATTCACCGTGAACGAGGCAGAGT
ATCACGGGTTACTACTGAGCTGCGAGCTGCTAGCGAAACAGACAAGGGGACGAGTGGTCATCCGTGGGGATTCCAACCTGGTCATCAGGCAGATGCAGGT
TGAAATTGATTGCAAAGCACTAGGACTACAATTACTGCGTCTCAGAGCCCTAGATCAACTTAGGTCGTGGCCGACACATGAATTCTTACACGTCAAGTGC
AATTGGAATCAAAGTGCGGATAGACTGGCTAGCACCGCTTTACAGCTGGAAAAGGGCATAGTTATGCTAACTGATCAGGACCGCCATAATCTGAAAGCTA
TCAACCGACTGGACGAAATATTGATGCCAGCGGGCAACGATCAAGTGATCAAGATGGATGCGATTACGCGATCGACCATGCGAAGGCGTGAGGCACTCAC
CATTATACAAGAAGACGTAATACAGCAGATGCGACTCGACCGTATAAAAAAGGCGAAAGACGAAGAAAGCTGGATTGCTAAACTCAAACTTTACCTAGTC
GGAGATGCAGCGGAACTGGGTGATTGTTGTATTTTTGCCCACGATCGGCGACAAACCTCGTGCTGAGCTCGTTCGTTTGGTAATCCCGGAGTTACTTCAA
GATGATATTCTACACCACTACCACGCAAGTCTGGAAAGTGGTCACCAAGGGGTAGGCCGCACGAATCATCGTGTTCGATCACGCTTCCATTGGAGAGGTT
TGTTCAGAAGCGTGCAGCAGTATGTGGGAAAGTGTGTCGACTGCGAAACCGGGAAGGAATGTCCAGCGCTATGAGAACAATCCCTGGGGAACATGCAAGT
TACGTAACCGTTCCAGATTATTGCAATGGATCATATCCCCTTCTCTGCCCCAGTCATTCAAAGGAAACAATAAATTGCTTCTTTGGGTTGATTTGTTCTC
CGGCTACGTGATCGGATAGGCTAGACCGTCGAGGACGGCCCAAACGATCGCGGAAGGATACGAAGAATGCGTCGTCCGGCGATTTGGAGCGAGCGAATCT
ATGCGCTATGATCGCGAACCTGGATTCATGTCGGATTTCTTTCGCGCATTCAACCGTATTGCCGGTCAAAAGCAGCGTGCTACAATGGCGTATCGGCCTC
AGGCAAATGGCACCGCCGTACGGATGGTCCAAACGTTGACCAGGGCGCTCAAGATGTATGTAACGGACGTGAACCAACAAAACTGGGATGAGTACGCCGA
GCGATTGACCTTCTCCATCAATACGGCGCATGACCGAGTCCGGGGAGATACTCCGTTCTATCTCATCCACGGATGGGACCCGCGATCGACGTTGAAAGCA
AACCTTCCGTTGGGATGCACCAAAACACGTGATAGCGCCATCTCCTGGCGCTATCACATACAGCGACAGTATCAACGTGCCCGGTACACCGTGAATGATC
GTCTGAAGGAAGCTATTCAGGACCGGTCTGACCAACACAACAATGATCAAGGGCCACATGGAATAAGCTGTGGTAGCCAAGTGTGGCTATATTTGGATCG
AGCGAAAGAAGGATATACCAGGAAGCTGGCTCACATGTGGCATGGCCCATTCCGGGTGATCGAAAAGTGTGGAGAGCATGCAGTGCGGCTGGAAGTGCAA
GGATCCCCATACCGATTGTTCCCGCTCGTGCACATCTCTAAGTTAAAATTGGTACGAAATTTTCCTGACCGACCTGTTGCACGACTGGAGGTGGAAGAAA
CCGAGCGACTAGATTTTGATGAAGCCCTACTGCCGGAAGGAAATTTAGCCAAAGGGCAATACGAGGTGGAAAGCATTAGATATGTGAGGTCGGGGCAAAA
AAACTCGGTATGGAAGAATACACCGACTGTTCCTGGTCCGGTGGAAGGGTCATAATAATGAAACCTGGGTAGATGAAGCGAACCTCAATTGTGGTGCATT
ATTGCAGAAATTTGAACGTGATCGAGCCAGACGGAATCGGTTTGAAGTGATGCAAGTACACGAAGAAGAATCCAGATGTTAGGGTGACCAGAGGTGATTA
CCTCGACACGACGAACGGTGATCGTCTGGGATGCGAGCGGAATGCAACAATGACCACGCGAGCCGGCAAAGGGGAGGATTACATGATTAACGAAGGTAAC
GATTATGGAACGAATAACAAAGGCAAATTGAGTAGTTACGACATGCGGTCACGACTGCGGCCACAAACACAATGGCCCTTTATACCAGAAACGACCAATC
ACTTCTCTACGAGCTTGTTCTTGAGGCGGTCGATGGACGATCCCGGATTACCAGCAATGGTCGTCCGATATTGATTACGCCAGGGATCGGCGGAGTCCGT
CAGGAGCAGGGCGGAGGCCAAATTAGGGATATTGGTTTGTCGGCGGCTAAAACCTGGATGCCGCAGGCATTTTTCCAAGAGTCCGGGAAAGTGCAGGAAG
AAAGGGTCTAACAGAATGTCGAGGTCGCACTGACCCTCGACCAACCCCTGCAGCACGATACGGAGCACAGCCTTCCACCGGGGACTAGATCGGGAACGTC
GACGACACTTCTATTCACAGTTGACGCTCAAACGAGGATCCTTCGCGCGGCTTGAACCGACGATGATTGGTAGCACATGGGTGGACTCCCATACCGCCTG
GCGGTGATGATCTTCAAAATCACGATAGGCAGTCACCAAGGCTTGAAATCAGCCAGTCGGGCGAAAAGACACAGGCGCGATCGGCCGGTCCAGGATGTCC
TATAGCCTCTGACCATATAAGGTGGCGATCTGCGCCGAGGTCACCAGTCGTGGTGACAATTGGGAATCGGCAGGCGGGCGAGCGCGAGGTTCCGGGACGG
GGAACAAGTAGTTCTTGGGTCGAGAGAAGTGGCAGAACAAGAAGTCCAAGTCCAGTGTACCCACCGTGATCAAACCCAAACGGCGAGACGACCACAGTGA
AAACTGGCCAGGGGCATAAGTCGCACGAGCGTGATACCCAGGTATCCACTTGTCACGCGAA