Description :
From Genome Similarity Track
Location :
Scaffold_127:8095- 10293
Transcript NameFunction/comments
Phypl_g3732DEAD/DEAH box RNA helicase, putative

Sequence
2198 bases(100 bases per row)
GCCAACAAGACTacggaggtggacgagctggactTTTTCGGCTTCGATGCGGCCCCGAAgcccaaggagaaggcgccCAAGCCACGCAAGATCAGCGTCG
ACAAGGTGCCGGAGTGGGCGGGCAACGAACCAGCCACCAAGCCGCGCAAGGTCAAGGGCAGCAAGCCTCgtcgcaagcgcaagctgagCGAAggcgcgct
ggaggagcagcgtctggaggacgaggcgcggcagcaggcgtcgcagctgctcgctccgccgaagacgaaggccgagaagcgcaaggagaagcgtgctcgt
cgccgttCGCGTACCGAGTCGATGGGAAGCGAGGCGGCTTCGCAACAGTCTGATGAGGATTCTGAGGCTGCTAGTGAaaatgaagaagaggaggaggaag
acgaggagtCTGTGACCTTGTTCAAGTCGAACGGCGAGGATGCGGATGCCCAGGCGACGACCGATGTGAAGgctgtgaagaaggagaagcaggaggccaa
gaagtctggcaagaagaacgctgttgctgccgaaCAGTACGTGGAGTGCTGCTCATCTATTGAAGGAGATGCTCTCTATGTAAAATGCTCACAGTGTGCT
TTGATTATTGTAACAGGGAGGGTGTTCAGTtgcttcgacgccagcttGGTATTCGCGTGAGCGGAATGAGTGTGCCGGCACCGATTACTTCGTTTGCTGA
CATGCGCGTGGACTCGAGTGCGAGTGCACAGCAGATGAAGCGTCTGCTCCTGCAGAATATTGAACGCTCTGAGTACAAGGAGCCCACGTCTGTGCAGATG
CAAGCCATTCCAAGCTTTTTGCTCCGACGCGAtgtgctggccacggcgccTACAGGTTCCGGTAAGACGGCAGCTTTTGCGATTCCTATGCTATCGAACC
TGGCTGCCGCTAGCGGAACAAGCAGCGGTATCCGATCGATCGTGTTGGCTCCTACTCGTGACCTGGCGGTGCAGATTCGTGCTGAGTTCACGCGCCTCGC
TGCGGGCAAAAAGTTGCACgtcacgctgctgtccaaggcTACTGCAGCTACCATCGCTTCCCAgaccaagagcaagctgGCTGTTAACCACGACGTGCTG
ATTGCCACCCCACTGCGACTCGTACACCTGATCCAAGAATCGAAGGTTAACCTGTCAACCGTTGAAATGGTTTGTTTGGATGAGGCCGACaggctgctgg
agctgggtTTTGTGGAGCAGGTCGACGAAATTTTTGCTGCCTGTACCCACCCCAAGGTTCAGCGCGCCATGTTTAGTGCTACGATGCTGGAGGGAgtcga
ggagctggctcAAACCGTGCTACGCGACCCTGTCAAGGTGGCTGTGGGCACGAAAAACGCTGGTGCTAGCACAATTGACCAAAAGCTGGTTTTCGTTGGC
AAGGAGGAAGGAAAACTCGTTGCCATGAAGCAATTGCTGCACGAGGGACTCCAACTTCCCGCACTGCTGTTTGTGCAAAACAAGGAACGTGCCAACGAAT
TGTACCAAGAGTTGCTGTATGACGGGGTGAATATTGGTGCCGTTCACGCAGACCGCACCAAGGAACAGCGCGACGATGTGATTCGACGTTTCCGTACTGG
AGAAGTGTGGGTGCTCATCTGTACAGACCTCATGAGCCGTGGCATGGACTTCAAGGCAGTCAACATGGTGATCAACTATGATTTCCCGCAGGTAAGAGGA
AGTATTTTGTACGCGTTTTACTAGGCATGGGTGGGATCTTACTTTTGCGGGTTTCTAATATTTTAACAGAGTGCTGTGAGTTACATTCACCGCATCGGTC
GTACGGGCCGAAATGGACGCAAGGGCAAGGCTGTCACGTTCTTCACGGAAGATGACATGGTGTACCTGCGTACGATTGCTAACGTGATGAAGATCTCAGG
CTGCGAGGTGCCCGACTGGATGCTTTCGCTGAAGAAGGCTAGGTACGCAGAACCTATTGCTGAGTTTGTTGTTGCAATCGTGGGACTAACTTACCTCTCT
TTGCTACAACAGCGTATCAAAGAGGAAGGAGCTTCTGAAGGCACCGCCCACACGGCACCGCATTAACACGGTCTCTGGATTCGACCTCCAGAAGGCAAAC
CGCCTGAAGCAGATGAAGCAGGCGAAACACAAGAAGGGTGGCGAGCCCAGCAACCAGGCTGAGCTAGTGCCTGCTAGCGatgagaagaagcaggaggc