Description :
From Genome Similarity Track
Location :
Scaffold_859:8094- 10308
Transcript NameFunction/comments
Phypl_g11326hypothetical protein PHYSODRAFT_356115

Sequence
2214 bases(100 bases per row)
GCACCATGGGGGCgtacgaggcgctggcggtggcgcagAGCGCGCAGCTGTACCTGCTGGTGGGGGCGCTGGGGGTCGTGCtgtacctgctgctggtgct
gtcctTCTTCCTCGTGCCCAACATCAAGGCGCAACACCCGGCGGCGGACCTCGTCGTGTGGCACGCGGGCTGCGGCCTCATGACGTCCGCCGGgctcgtc
ttcgccttcgcgctgcagcggcgggaCGTGGCGCCgcaggacgacgcgctcatcCACTGGCAGTGCGCGCTTCTGGGGCCTTTCAAccagttcttcttcc
tcgcgGGCGCCTGCTGGTACCTCATGCTCacgctcgacctgctcgtggcgctcgtgaacCCCTGGATGGGCTACAGCTGCAAGTCCTGGGCCTACCACAC
CATGTACGACGGTCTTCGGAGCCCCATGGGTTGATGCAGAGATGTGGACTGACTCCTCTCTTGTCGtattgctgcagcgtgtggaGCGTGAGCGCGgtct
cggcgctgctgctgcaccagctgaACCTCTTCGGCCTCTCGTCGCTCAACGTCTGCTGGGTCAAGCGCACCAAGGACCCGATGCAGGTGAACACGGCCAA
CTGggtcttcctcttcgccaTTGTGGGCGTCACCTGCGTCGTCTCGCTCGCagtgctgctcttcgcgaGCTTTCGCTTCGTCAGGCGACAACTGGACGTC
ACGTATCGGGCCAAGCGCCGCAACTTGATCCAGTACTACCGCTACCTGCTCATTTTTGCGGGCCATTGGGCGGCGTGTGGCGCGCTGTACTACGCGGCGT
ATCGCCAGCAGTTTGACGGCAAGTTAGCCAAGCACTTCGAGCTCGCGTTCGCGCTGGTCTTTGGATCGTaccccgtgctgctgctcatggtgTGGGTGCT
GAACACGGAGCTGTACCAGAATTTCTCGAGCGAAAACAACCTCTCGAAATCGGAGCGAGGGGCGGGAggctcgacgagcacggagCATTTCAGTGCTGCG
CTGCGCAAAGACTTGATGCGATACACGACTGCAGGGAtccgctgcagcatctgcgagTCCCCTGCGGACAGCTTACGTTCGCCGCTGTTGAGTCTGGCTC
GGGATCGTTTTGGCTCTCTTGATCGAACTGCTGCGTTGTCATTTTTAcaactggaagaaggcggctCGGCTGGCCTGTAtcacgagaagaagcggttggc
gacgacggtgTACAATGGCGAGTATCGGTACTATGAGAAGCTAGGTTTCACCGACTATGCGCCCAAAGTGTTCCAGAACATCCGCGAGATCTGCGGGATC
GACAATGACATGTACGAGCAGTCGTTCGCTGACACTCTCCTAGAGCGCGCATCGGAGGGCAAGTCGGGAATGCTGTTCTACTTCACTAGTGACCGCAAGT
ACCTGGTGAAGAccatgacgaagaaggagcattcgttcctgctggaggtgctccCACTGTTCCATCAGTACATTTTGAAGCAGCCGAACTCGCTCTTGTG
CCGTTTCCTTGGCTGTCACTCGATGCAACTTCCCGTCGGATGGAACAAGATGTTTTTCGTCGTGATGGAGAACATTTTCTCGGATGGCCCGGTCGACGAG
CGATACGATCTGAAGGGTATCTTCCACCAGTCCAACTTCAGGTACCAAGAAGGAATCCCAACACCAGTGTCAAGCGATTGGAGTCGGAGtggaagagaag
aagaaggggTTGTGCATATTCCGGATGAAGATGCGTCGAGCGAGAGCCAAAGTGTGGACAGTGAATTGGGACAGGTTACAGAAAAGCAGCCGCTCTTGCG
TCGTGGTAGCTCGCGTCCTTCGCTCCGGTATGACAATGACTTTGTCATTCGCCGCGCCTCGCTTCGTGTGAACCCTACGACCCGTGCGAACCTCCTCGCC
CAGGTAACAAGCGATTGCGGGTTTCTCCAGGAGCTGGGAATCATGGACTACAGCTGTCTGCTCGGTATCCGGCACTACAATCATCGCATCGAGCCCGATA
TTATGGACAATCTGGCGCACAATGCCGTCGTTTCAGCAGATCAGTCCACCGTCTACTATCTCGGGTTCGTAGACATCTTGCAGCACTACAACATCGGGTG
GAAAATGCAGCACTGCTTGCTGGCTGCGGTTGTCGACAAGCGACAGATCACGGCGCTCCCACCCGCTGAGTATGCACTGCGATTTTTGAACTTCATTCAC
GAGTATCTGCTGCG