Description :
From Genome Similarity Track
Location :
Scaffold_59:80934- 82286
Sequence
1352 bases(100 bases per row)
AGTCCCATTCCTCCTGCCTGTTTAGGTGCGAAGACTAGGCCTGGAGCGACCTTGTGACGGGTACTCTCTGTTGCCGTTGCATGCCTCCACAGAAATTGTT
TTTGCAGATTCCTGAGTTGCTTGTCTGCCCATTTAGGCATGTCGAAGGCCGCTGCTGTGAATAGAACCGAGGGAAGCATAATGACGTTCAGGATGGTGAT
CCGATGGTCGATGCTTGTTCCCAACTTCGTTGCCGTCGCTAAACGTCTTTGGATGTTGCGAATCCTGCCTGCCCAGTTGATGGCTGTCAACGGCCCAGTG
CCCACTTGATAACCCAAATATCGGACGGTGTCACCTCGTCGAAGGACCGGTAGGCCGAAGAACTGATGTTCTTCGATCGCCGTGTTTAAGAAGATGAGCT
GACTTTTGGCTGGTTGCACCTGCAGACCCGAGAGTTGACCGAAGCGTTCTACGATATTCATTACTTTAGGGATCTGGTGAGCATGCTGCAGGAATACTGT
CGAGTCATCTACGAACGCAGAGAATAAGTGCCGCTGTCCTCCTGTTCCTGGGACTTCCAGCCCTTGCAGTGTGGTGTCCTGCTTCAGTGCTAATACTTCC
GCCGCAATTATAAACAGTAAAGGGGCTACTGGACAACCTTGACGGATACCCGAGACAGCTGCCTGCGATTCGGAGAGTTCTCCATTTACAAGAAATCTTG
CCGTTGTGCCATCATGCAGCCGCCGTAAGAGATTCACAAATTCTACTGAAAATCCAAACTTTAGTAACGCCAGAAACAGAAATTCCCGCGACACGGTATC
ATAAGTTTTCTGAAGTCGAGAAGGAGAATAACTCGACTTAACAATGCCGAGAGTTCCGGTTCTCCTCGAGCCGTGGCGGTCACAGCCAGCATCATCATGA
CGGTCTTTATCATCTGTCGGCCGTGCACGAATCCCTGTTGTGAGTCGCCGATCGGTTTGCCGATAACTTTCTGCATCCTGCACGCCATTACTTTCATGAA
GACTTTGTACGCGGTCTGTAGAAGTGAGATTGGTCTGAAGTCCATGGCATCTACCGAGTCTCCTCTCTTCCTGAGAGGAATAATCAAACCCACCAGGAAG
GAGGGAGGCGGTTCCGCTCCCGCCAGTAACTTGTTTCCTATCGCTACCATTGCGGGAGCAAGGACCGGCTGAACGTCCTTGAAGAAGTCTTTGTTTAGCC
CATCTGGGCCGGCCGCTTTGTGTCGATTGAGTTCGGCAATGGCCCCGAGAACCTCATCAATCGTGATTTCAGCCATTAATTCTCCATTTTGTTGCGGTGT
TATCTGCCGATCTCCAGGAATGTGTACAAATTTGTCGAATTCCTCCTGCAGT