Description :
From Genome Similarity Track
Location :
Scaffold_34:80933- 82596
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011172Similar to Sh: Potassium voltage-gated channel protein Shaker (Drosophila melanogaster)
Pytul_DAOMBR144PYU1_G011171Similar to DDB_G0290301: Uncharacterized protein DDB_G0290301 (Dictyostelium discoideum)

Sequence
1663 bases(100 bases per row)
ACACATGATATCAGCCACAATCTGCCTTTTCGCCATCAGGGAAAAAAGCACAAATAAATAGATCTTTATCCCACGAACCGTGATCTGAAGTGGCGCGAGC
GACTCGGAGATCGCTCGGAACATGACTTTGGTGCCTACGTACACATAGGAATTCACGAGCAACCGCACGATGCGAAACAGTTGTAGCGCATTCATCAGCC
GCCCTATCTTGTCGAACTTTGTGCCTTCGAGAGATGCGACAGGGACGAAACTCGGCAGCAGCGCGAGAAAATTCACCCAGGTTCCCGGCGCCTTCCAGTG
CTGCACAGGATTCTCGGCGGCCACCCAGCGCAACACAAACTCCACGGCATACACTATTGTAAACAGCGCTCTCACTCGTGTAAAGCTCGCTTCATCGGGT
AAGTACGGGTACGCAGGGTCGGCGCTACCTGTGAACCGCGGTCCGTCGAGTGTGTGGGCGGCCATGACTGCGATGTTTAGGGCGAGCGTCACGAGGATGC
AATGGTGGAGCCACCAGCCACGCTTGGATTCCTCAGGACGGCTCAGGTAGAACCGAAGTTTCTCTCGGCGCGACATCGCGCGAATCCGTTCGATTGTGCG
CACATCTTCTTGAAGAGATAGCCGCCATTGGCCCCACACAACCGTAAGCAGCGCGTGACGAAGAAGATGCGCCAGCAGAGACGATCGCGGGTGCTTGGTC
GGGATAAAATGACAGGTGTTTGCTGGTGGAGTCGTCGCGTCCGTGTCGTCGGCATTATGCTTTGCTGCAGAGGGGGCACGGTCACTCGCAGGATTCTTCG
ACTCGGTCTCCATGTCGGCCACCGTCGAGCAATCCACGGCCCCTGGGACACCACTCACGTACACGCGCACAATCTTCCCCGCGGCACGGCGGGCCATGTC
GACTGCGCTCATAGTGGCCGCGCCGCGCTCTCGCATGGCTTCTCACGTCTTCGTGTGTTCGTATGTTCGTGCGCAGTTAAGGCAGCGTTTAGTAGCAGCG
CTGTTCACGTGCGCACGCTAATTATATGCAACCGAAACGCATTTTAGAACAGGAGCACGAGCGTCACGACAGCCGATGAGAGGAGCGTGCGTGGACAGCG
GAGACGGGCGGCCGATCAGAGCGCCACACGCGGAAATAGCCCACTGGCAGTGCCATTTCCCTTACTGATCTCCGTATCGCCTTCGGGCATAAGGTGTGAC
GCCCATTCTTTTAACTATTGAATCCCGTGATTTTATAAAATACCCTAGCAGAATCAGTAACTTATTCGATAAATCGTTAAGCTAAAACTAGTTAATTTAT
AGAGCTCATACCTCGGTTTGGTGTTCGATCAACATACTGATATACGTGAACTATCGAGAATCAGATTGCTTTTTAGGTGGAGTCGAGACATCGAGCCACC
AGTTCGCATTTCGAGACGATTCCGCACGACGAGAAGCGCTGCCGCTGCTGCTGCTGCTGCTGCCACCAGTCTTCTTCTTTTTTTTCTTCTTCTCACAGTC
GCTGCGCTTGGGCACGCCGTGCTTCAAATACCAGACCTGCCACGCGGCGTACCAGTTGAGCCACGTCCAGTACTCCTCCCACTGCGCGTCGGTCACGAGG
TGCTCCATGCCAGGAGGAACGATCGGGTGGTGCGCATTGCTCGACGCGCTAAACTTCGCTTTT