Description :
From Genome Similarity Track
Location :
Scaffold_702:8093- 11110
Sequence
3017 bases(100 bases per row)
CAGCTGCAGGAGTCGGTGCGGTTGTACAGTTCCACCGGTACTCAACCCTTGCGGCACGCTCAGTCGGTGATCGCTGAGCAGCGAGCGGTGATCTTGCGAC
AGAAGCGGCTCATCCGTCGGAATGGTATTATTCCGATGCACGATCCTCACATGGCTGCTGCTGCTGGCGGTGGCTTGCAAGTTCCTGGGCTTGATCCGTC
CGACCTTCTCCTCAACGCCCGGCTGTGTCGTGTCTTGGAGTCTCGCTTTCCTGAGGTTCTCAACATTCCCGCTGGTGAAACTCGGCGGTTGGAGTTGATT
GTCCATCCTCGCCGAGATGCTCCAGTGGCGAGTTCCGTTATTGGTCCTGGTGTGGTTCCCTCAGCTAGTCAAGGGTCTTCGACGACTTCATTGGCAGACT
CGGCTGCGGCTCCAGTCAGCTCGGCGGCGGTAACCACTCAGGCTGAGCCGACTCTTGCTCAGCTTCACCGTACGCCTTTGGCAAACTTGACCTCGACTCA
GCAGCTTCGGCGTTATGCCAACCCCAAGTCTCTCACAGCCGCAGGTCCTCGTCAGCGTACGCCGGCGCCGCATCCGCCTCTTTTCGTACGCTTGTCCACT
CCCCGGAGAGGATGGACACGAGGCTATCAGTGCCCTTTTGCACTCAAGTTCGCCTCAAGCTACTGCATCCGATGGAGGAAAGCCTCGCTCTGGAAAGTCC
CGTCGTCGGACTCGGCGGAAGAAGGTTCGTCACCTTCAGCTGAGTTCTGCTACTCAGCCCGCTGTCTCTGCTCGCTCTGAAGACGACGGTGACGCTTCGA
GCGAAGCTGAGTTTGAGTTTGAGTTGCCTGAGCCGCCCGCCGACACCGTTCCTGCAGTCGCTTCGACGACTTCGGTGGGTTCTTCGTCTTCTGGCCCTCC
GGTGACTTCGTCGGTCGCGGCTACTCGCCCACCGCCGATATCTTCATCTGATGTCGTGGCCTCACTGCCTGTCCCGGCTACCAGCGTGGGTGCCCCAGGC
TCGACTTCGCCCATCTCCGCTGGGTTGCCCCAGTCGAGCGCACCACTCAGCGTCGTGCTTGTTGGATTTCAGCGTGCACAAGCCGAAACAGCATCTCTAG
ATGGTGACTGTAGCGTCGTAGTTTAGGAGGCTTTTAGTCCAGACCAACATTGCCTTGGTTGGTCATGGTTTTCCCTCACCACAGAGTGCTTTCTAACGCT
AGCACTATTCAATCTACCTTGAAAAGAACAATAGGTTATCTGCCCCAAGCTTTCTCTGTGCTCAACGTGCTACCGTTGAGGTGTCGCGGTCATGGTGAAA
TGATACTCCGAGAAAAACTTCGACGGGACCAACTACACGGCATGGAAGACGCGTGTACGAGCCGTATTGGAGGCGAACGATCTCTGGGACATCGCAACGC
TACGTGAACGTCCGCCACGCAGTGGCTCAAGGCATGACGAAGACAGGTTTTGGCACCGAGAACGTAAAGCAAAAGCTTTCTTGCTGGAAACGCTGTCCGA
CGATCTTGTGGTAAGTGTTGGTGCAAAGCGGTACGCCTACCAAGTGCTAGAGTACTTAGAGCAAACGTATGAGGCCAAAAACTGGGGGGAACCTAGTGGC
AATGCGTGAGAACTTCATATCGCTGAAGTACGAAGACGGACAAGAAATCACTACGCACCTCAACAATCTAAAGACTCTAGCCGACAAACTAGCCCGCATA
GGAAAACCCGTTGATGACCAAGAACGAGTGTGCCAACTCTTGACAAGTCTACCCGAGTCCTGGTCCCACTTCAAAAGTGTATACTTTACACAAGACCGCC
CACTGCCATGGGCAACAATGGAAGGCAACGTTATGGCCGAATTCTCGAGACGCCAAGCCCAAACGGCTCCAGTAGTTGTTCAAGAAACGGCCGTACCCGC
TGTCTTGAAAAACGAGGTCTACATGATGGCGGAGGCCTTACTTGCAGCACGCCAGAGTCACCTCAATTCGAGACGCACGCAATCCCATCGATCGACGCCA
TACCCACCGCGGTCGAGTAACGGGCAAACATGCTTCTATTGTGGCAAAGGGGGGCACCAAAAACAAGTCTGTCGGCTTCGCCTTCGCCACCTCCAAGAAC
GTGGTGTTCCGGAGGAGCAACAAGGTTCTACCGGACACGCAGCGGTAACTGTGGCGCCTGCAAGCCCCGCCGCCAATGCCGCCGAGCGGACAGAGCAACT
ATCTCCGGCACTCGAAGGAGAGGTATGGGGTCTGGCGGCAGTCGCAGGATATGCTGCGAAAACAAGCGCGGATAGTGTGTTTATTCCTTGGGTGATCGAC
TCGGGGTGTACCCAACACATGACGTACGACCGGTCTCTCTTTGAGAAGTTTGAAGCGGCCTCTGGACGAAACGTTCGCGTGGCAACGGCTACAATGACTC
CTGTAGAAGGGGTTGGTACAGTGCTGCTCACGGTGCAAATGAACGACGGCCATAACGAACGAGTCAGGCTCCACAAAGTCCTCTACGTGCCGGCGCTTGA
AATGAACTTACTCTCTGTGTACCAAGCGGCGCAAGGAGGGGCGAAATTTGACTTTCATACGCGACCGGGTTCCGTGACAATGTCACTGTGGTCACCGCCC
AAGTTTAATGTTTGGCGCTAACACAATAGCTGTACGTCCTGCATTCGGGCCGGCCCAGCAGCAGCAGCTCTCGCCGTAAGACCGGAGCTGACGCTGGATC
TCCTGCATCAACGGTTCGGGCATACCAGCAAGCAAATCTTCGCAAGATGGCGTCTTCTAAATTGGCCAGTGGCATGGAGTTCAAATCGGAGCAGGATAAT
TCACCATGTGATGCCTGCGAGCTGGGTACGAAGCGCCGCGCGACGTTCAAAATAAAGCCGCGAGTTGACCTGGATGGCTGCAATAATGTTGTTCACAGCG
AACATCGCTGGACCTGTCGAATTGGCAATCAAATCAAGCTCGAGCGATATGTGTTAACTCTTTGGTCCGATGGGTAATTCGCGATACTGCACTGGTGGCG
GGCTGCTTGCGAAAACC