Description :
From Genome Similarity Track
Location :
Scaffold_12:8093- 10930
Transcript NameFunction/comments
Phymu_g877hypothetical protein PHYSODRAFT_286439
Phymu_g878hypothetical protein PHYSODRAFT_302462

Sequence
2837 bases(100 bases per row)
GCACCCATTTTTTAATGATAAGTACCCATTTCAAGTGAGCAATCGTCCCGTCTATTGTTCGATTTTCGGCTGTCTATTCTTATTGCAACAGGAAGCCTCC
GTCGCCAGCAGACCGTCGTCACCGGCTTCATTTCGTGGCAATCCCGACCAAGTTCATTTACGAAAAAGTGTTATCCATCAAACATGACCTCGTCCCGCTC
GAGTTCCAGTGCCGGATGCACGCTCtcgctgcagatgcagcaaccAATGACCATCGGACAAAAGTACGCAGGAAGTAGCCGCCGCCATCACTACTACCCA
CCGCCGACGCCGCGGAAGCTGCGCCAGCGCTCCTGCCTGCGCAAGGACAGCGCATTCGGTGCCTCACGCGGCTCGAGgctggacgagctgtccACAACTA
AAATGATCACGGTCAGCTACTCAGCCGCTCCCAAAAAATCTCTATCCTTCGCTGATCAACGCGGGCAGCACCTtgtgctggagcgcgagttCTGCCCCAA
GGACGCACCTGTGTGCTACTGCGACGTCCCGACCGAGATTACAGTCGACCGCCTGACGCGccgtcgcagcagcagtctcgaCAAGTGGGTCGAAGAGACT
ATGGCACGTCAGCACCTGCTTTCCATGTGTGTAGTCTCGCTGCTGGGTTGCGCGCTCATTGGCCTCCGTCAGACCGCCAAGTACTAGTAGGTtcatgtac
tacatgtagtactaATTATTATCAGTGCATCGCTCTAGAGCTCTAGAGCGACACCAACTTATTATTGTAATACACCGAACACCTCCACTCTGGCTTGACC
ACACACGTTATTTCCGGCGCTTAGTAGCCCACGTCTTGCCGATCTCTGGGAGTCTCAGGCGGTGTTTGTCCAGTTcgacgctctgctgcaggatACTGCT
GAGAATTAGTTCCGGGGAGTACACCCGCTCTGGATTTGCGCTCGCGAGCTGCTTACGCACTGTTGCCACAGCCAATGCAGCCTCGCTTGTGATCACTAAG
TCGTTAGCCCCAGGCTTTCCCTTAGCCGAAGCCTTTCCTCCTGCGCACTCAACGATCTTCACCAGATCCTTCACTGGAGGCAGCACCGACTTGTGGTTGG
TGATAAACACGCTGTAGCCGGCGAGTAGACGTTGACGCTGAGCCACAGACACGCCATATATAGTGTGTTTCAAGTCGAACTGCCACTTGGCTTCCGCCTC
CTCGTCGTGGAGGCAGTTCGCTTGCTCATCGACTGCGGTGCCGACCCGCGCCGACTCATCTAGCCAGCGTTCGCCAAGAACATGTCTGCAGCACGAGATA
CCGCACAGCAGTTTCACCGTGCGCTTTAGCTGATTCTGAGGAGCTATCACATGCGTAGCCGTCTCGATGTTGCTCTCGTATATAGCGCCAGCTATCGCCT
TGATCTTCTTACGGATCGCAGCAGTGGGCTCTAGACCCGTCAGAATGATGCGGATTGATTCACCCTCGACTTGTGAGCCTGACGATTCGCTGTCTGTAGC
AGATCGACTACTTGGTGATCGCTTCTTGCCGCGGCTTGAAATCGGCGACTTCCGCACCAAACGTGACGGCGTCGGCTCCTGTACAATcaaagcagcttca
gaaGCCAGGTTGGCTTTGTCTTCTTGAATATCATCAGCAACATCATCATCGGAGATACTCTTAGATGCAGCAGGCTGCTTCTCTTGAAGATCCGCTGAAG
GGCTTTGGTCCTCCTGAGCTGTTAGGTTCAAACTCCCTGAAGAAGTACTTGCAATCTGACAATGCCGAGACCGTTTAGCGTTTGCGTGATTCTCTTTAGG
ATACTCGCTGTGGTCCCGCTTCGAGCTGCGGCGTGATACGGTTTGCGTCGTTTCCGGTGTCGATAGTGATCGACGCATACTCGTTGTGTCCGGTGCAGGA
TCCTCTTTAGCGGTTGACTTCGAGTAGCTGAAACTCTTGGTTAATCGCGGTCTCAAACTGCCCTTAGATGGTGTTTGTTCACTCTCCTTTACTGCCTGGA
ATTTCACAGGCGATTCCTCTTTTGGTTCTCCTTCAATCTCTGTCTCCCCACCACTGCTGTCCGAATTGTCGCGAATTGAAAGAGCTGGGGAAGCTCGAAA
CGGTGTGCGTGGCTTGTAGATTCGCTTCTTCACAACTTCTGGTTCTTTCTCTCTCAGCTGAAAAGAAGCTGCGATAGAAGAGAAACCAATAACAGAGCCG
TCTTGCTCCAACATGTCGTCGGACATGTCCGAATCggcatcatcttcactgTACCCCATACCAATACCACCAAAGGATCTATATGTGCCGCTCTCTGCAG
ACGCTATCGGTAGCGGTACCGCCTCCTCAAAGATTTTCCGTTCTGGTTTAAGAGCTCCTAGAATCATTCAAGCCGTTAGTCAGCTTCCATCAGACACTTC
ATCAGACTTGCTCTTAccgtcttgttcttcagaGTTTGTCATGCGAATCTGcgtctcttcctcgtccacctcctcttcatcacaAGACTCCTCTTGACTA
GGCGTAGCAGCAACGAACAACGGCGCTTGTTCCTGATCAGGCTGAGTCACCACTTCGGTCGCTATTTCCGTGGCTACTTCTGTTGCTTGACTGTCGCGTT
GCGTTTGCGTCGGTTCGCCTTCCAGCTGCGACAGAGTGCCGCGTTTGCGGTAGTTGACAGTATACCATTGGCCTGGCGAGTCTCGGAAACCCACGGGGGT
GTCCTGCCCAGACGAATCGCCGCCGTATACGCATGCGGCCTCGCCAGCCATACTCACTCTTTGTCAGTAATTGCAAAATGCAGTGAGATAAAAATATGCA
TTTTGATGGTATTTGCAGGTGGTCACCagtggtcatt