Description :
From Genome Similarity Track
Location :
Scaffold_33:8090- 9373
Sequence
1283 bases(100 bases per row)
TTATTATTGCGAGCTTCCTCCGCATTACAGTGTAAGCTAGTAACGGTATCTCTTACCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAG
TCTACGATGAGCCAAGTCCAGATCTCCGGGGCGACCCTGGAGCATGCTGCATTCCCCCATCTCACTCGCGTGTAGTGGGAAGCGCTTCACCGCCTCGTGG
CGGTGTCCGGAGACGCTGTCGTCGCATCGCTGCTGAGCTCAGCGACGCCCGACCAGCAACGTCTTGCAGCACAAGAGTTCATGGAACGCGAGCTCGCCGA
TGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTCGTCAAGATGGAGACGTCTACGTATTCTGGCGCCGGTGAAAACCGGCTTCCG
CTAAATCGGTGGTTCCGCGAGATCGACATCGCTATCGCCTCGCGACGCATCGAGGCGTCATCGGCCAAGATGAACTTCCTCCTCTCCCGGTTAACCGGGA
AGGCCAAAGAATGGGCCCTCGGGAAGCTGGTTGTCGACCCCGAGGCTTTCCCGACTCTGGAAACTCTCCAGAGCGACTTGCGCCTCGCGTTCGAGCCCCC
GCAAGATGAGTCTCGCGTTCGCGCAGCGTTCTTCGCTCTGCGGCAAGGGCAGATGTCCATGCGTGATTACGTCCCAGAAGACGCGACATCTGGCGTCATG
CATCGTGACCAAGCCAATCGACATGGCCTCGCAAGTCCACGTATTTGTGTTCGGCATGCGCGAGGGTATGACCCGCTACTGCCTCACCAGAGCTGAGCCC
TCCTCTCTCGAGGAGGCGTTTGCACTCGCGATTCGCGAGGATTACATGGCCGCTGCATCGTACGCCGCAGCCATACCTGCGGAAGCCCGAGAGTCTACCC
CCGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGCAATCGACGTCGCGGGTCCTACCGCGGCAGCGCTGGGCGAAGCAATCGCTCCCTCATTTGCTT
CCGCTGTGGGAAGAAGGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCCGTCGTCTCTCACGTCGACGCGGAACACTCCTCGGTCGCTCATTCAAAA
AACGACCAGGACCAGTAGGGACGCCCTACTGGCTTTAACGAAGGACCGGGCCCTCCGGTGGCAGCCCAACCTTCGAGCCCTCCCGTGCTCCAAGCACACA
CCAATGCCACCACTACGCCGGGCGACTCGAGACTGATCATTGTCAGCCTCCACGTCACCGGTGCCCGGCGACCACTGCGCGCG