Description :
From Genome Similarity Track
Location :
Scaffold_461:8088- 9798
Transcript NameFunction/comments
Phyke_g9758hypothetical protein
Phyke_g9759hypothetical protein PHYSODRAFT_531070

Sequence
1710 bases(100 bases per row)
AAGGTCCCGGCTGGAGAAGAACATGCTGTCATTCCAAGTGCTACATCATTTGTGATCCCTAAACGATCGTTTGTAAAGACGGCTACTGCCAGGCATACAC
AGGAAGCCCGTATGGCACGAACGGCTCCAAGTGGCCCGCGTGGTGGCAACTACTCTTTAGAAAACCGTATTCCAGTAGCCATGAAGCCCCTGCCTCCTCC
TGATTCAGCCCCGCATACTTCAAATCGAGACCCGCGTCCTCAACGGAAGCGAACAAAGAACCCGGTACCAGTGAAGAATTCAATGTTCTCGACACAGGAC
CGCTCCCTTATGCGCTTGGCCAAGAAACGCAACTCAATTttcatggcagcagcggAGCTATCAGCTCAAGTACCCGGTTTTCAAAAAGCATCGGTCGTAA
CCCACATGGTGGGGTATGAAGTCTATGATGTGAATGGAAAAGTGTTGCCAGATTTGATTTCTCGCTTGAGCTGCGCTACAAAACGCGAGATGGCTTCAAA
TAAAACTTCATATGGCGCGTCATTTTTTGGTGTGGCAATCTCTGCTCCCGAGGCAAAAGGAAAATCCGGGTCGAAGACTGACGATGAGTGTGGGGGTACC
GAGAGCGACGCTCGGAAAGTGAACTGCTACGAGGAATTACGCTTCGAGCGCCCAGAAGATAGGGAGTTTTATCAACAACGCATGTATGGTGCAAAATTTG
TGCCGCAGCAACTTCGCGGGCGAATAACACTGATCGTTCGCAATGCGCGCTTCGAGCGTAAGTCGACGGGCATCCGGTTTAACCAAGACCGCGACCGCGA
GGAGTTTTCAGCTTCGCTCAGCAAGCGCTACACATTTAACAATTCGGTGCCGCGTTGTGAGATCCCGCGCGAAAATTGGCAGCAACTCATGAGGAATCGT
ACAGCATCCGTGTATCTTCATTACTATAACCGTGAGGACGCGGAGCGAGCATCGCATGTCTTTCGCGACGATAATGGAAACCCTCTGGAGTTCAGGCATG
GGTACAAGGCAGGTGTGGTGATCAGTCGGAGCTCGTCCCCCGCATCTGCAGGACGGTTACATCGGACCCCCCGACGATCATGCTCCAGCGAACGAGGTGT
ACCggagccatcgccatcttcgtcgcaGAATAACAGCGTGCGCAATACGCCATCGTGCCGTCGCTCTAAGGACTTTGAGCCTGTCGGCTCGTACGATAAG
AATGGTCGAGGCCGGCGCATGTATCCGGATGATTTGGGTCGCTACAAGGGGCGTGACAATCGAAACGGAAGGTATGATGATCGCAGAGGAGGTTCATATT
CAAGACCTTACTAGCAGGGGTGACGTATTACGGAGGCAAATGTGCTTCTGCTGGGTTCAGGGGTTGCTTTCTGTCTGGGCTTTCTTCGTCGTTTACATGG
CTTTGTGCAAAAGTTATCAGCTTAGGTATTTAACTGAGCTGCATTATTTTTGAAGGCAAGTTTTCACGTATTTTGGAAGCGTATTTTACTAACTGGTCTT
CACGCATACTATGTCGTATCTGGTGAAGAAACTTACACTGTGCCAGGTTCCGCCTCCAATACACTCTTGTCGGCATTTTTCTTCACTTTCGGAATCATAC
CGAGCTGCATACGGTCCATCACCAtcacgaagacgaagataTTGACGATCATGATGCCACCCAGCGTGAAGAACAGATATTCAATGTGCCCGTCGTTCAG
GTTCGATGGA