Description :
From Genome Similarity Track
Location :
Scaffold_10:80857- 85917
Transcript NameFunction/comments
Phymu_g792hypothetical protein PHYSODRAFT_343916

Sequence
5060 bases(100 bases per row)
TCTCTCGATGCAATCTTGCAGATCACATCGAAGGGGATGGATGATGTCGCACCGgaagcaagaagagcgtaTTCTGTCGTGGTCGGTGTAGTTCTTGCCA
AATACGCGACTTCATcgtctggagaagctgaagtgCAGGTAGGAGGTGACAGCAGTGGGGCGAGTGCCGCTTCTTCGAGAAAtaacgaggaagacgctgg
tggaagAGCATCACTCGAACACGACACGCCTCCGTCCAGTGGATCTGGGAAGGCCAAAACAGGCTTCAAGCTTCACGTTCCTGGAATCAACCTGCCTTCA
TCACTATCACGCCGGAAAGTAACGATGGTCAATTTCTCCACCATTGCAAACGTGGTTCTTTACTTCAAGGACATGGTGACCAGCAAATATCTATCTACGA
ATCCAAACCAGAGTCACGGAGGCATCTTATCCTCCTTTTCTGTTGCTTTGTGCAGCATGTTCGAACGGTTACCGCCTGACGCAATAGCCGAGTCGCAGCT
TCGCGAAGTCATGGATGCCACGCTTGCAATCCTTGACCACCCGTTCGCACTGGGAGACTTGACCCGAGCTCGTAACGCTGTGGGTTTCGTGCTGCGCTAC
GGACTTAATGGATGCTTAACAGAGCGCCAGCAAGaggtgctgcttggagcttATCTACAAAAACTACGAGATGAATCGCAGGCTTCAGAACCGAATCACC
ACAAGATACTGTCGACGCTAGTGGAGATGAGTCACATGTTCCACTCGATGGGCGAGGCTTGTGTGACTCATGCGCGTGATGCCAGTGACGTGCTGCAAGG
GCTTATTTGCCATGAAAAACAAAGCGTTCGCTTCCAAGCTGCCATCGCGTTGGCGTCTCTTGTCACTGCAATTCCGTACCGGCTTCAAAGTGTGCTGACG
AGCTGTCTTCAGGGTCTTCGTGATACTGCTGAGTACCTCATGCGTGGAGGGTCTGACGTCGAGGAACTGAGAAGCTCCGAGTCTGAAAAGGTAGAAGATG
GCCAAGAGGAAGGCAACGACATGCAAAGCAAGACCCATCTGTACGCGATTCAAGGGAGATCTGCGGCCATTGCCCACATTCTTCGTGCCATTAAGCTTGA
TGGCAATGGTGGCTTATCTCAAACCACAATGGACGATATTTATTCCATCTCCGAGGAGCTTGTCGAAAGTCAGTTCCTGAATGAATGTGCGGACAGTATC
TGGCTCACCTGTACGCGCGCTGGCTGGACGTTGGTCGGAAGTCTTGTGGCCATGAATGATGAGCAGTGGACTAAGATCAACCTGGAGAAGCTTTTGAATC
TTTGGCTCAAGTCCAGCGTGCTGCATAGTCGAGAATCGtctctcgagctcctgcgtATTGAAGCCGCCGTCATCGCTCTGAGCAGTTTCCTTGCCAATTG
TCAGAATGCAGCTGAAAACTCTGACAGCGACGTGAATATTCTTGCGAGTCACGTACTCCACGTATACTTGACGGCGACCCAGGACACCCTGAGCAAACCT
ATCAAGCGTCGCGGGCAGATTGCACGATACCGTCTACTGGGATGGATCATCAATTGCTTCTCGATGCTCCCTCCAATTTACAGCGACTCATACATCGTCC
TGTTGGATCTTATTGCTGAATTCACTACGGCCCAGGCGTTGATGAACCTCAGACATTCGTCCCTGGTCCCAGCAAAATCCACATACCTCCAAAGCGTGCT
TTCTTCTGACGATGACACGCTTGACGTTGTGACCCTCTCGCGGTTGAATCCTGGAGACTATCCGTCGCCGCTCTACTCAAGGGAGCTGAACCTTGTGCTT
GGCTTGCAGCAACGAGAAAATGCTTTGACGGATACTGAGCTCGAGGTCCAATATCTCGACACGTTTTTGAGGTCAATGACTGAAAAAGAAGCTATCGATG
GTGTGACCAAGcgagcaagttgcagtccGTTCACTTACGTTCGGCTCGTGGACACTAGTGTGATTTTGTTTGGTCGACTATTCCACTCGATTCCAGAAGA
TCTTCAACTGCGATGTCTTCAACACTACGCCGGCGCTCTATCCGATGTTCGAGCTGATTGCGAAGTCAACGTGTGTTCGTTACTGTTCGCTGTGATTGCA
GAAGCAAGGCGTCTGGAGAAGTCCGGTACCGCCTTaacgtcttcagcgtcgctTTCAGCAACATCGTGGCCTCTTCAGATGCAAACGATGCTGTGTGAAA
TGATTTCGAGTGAAAACACGGTGgttcgtcgtggtgctggtgagGCACTTGGCTCTTTGGCGGTGATTCTAGGGGAAGACCATTGCAAGGGGCTGATTat
cgagttggagaagcgTTTGGTGGTGGATAAGCTCCCACAAGGGGCCTCTAACGCTACTTTCGGCGCCGCCGCGGACTTAGATGTGTCTGTTCTATCAGCT
GGTGCAGCCTTTGCGTTAGCATGCATTAAACGCGTCTGTGGATCCCGTATCTCTATTGACACCGGTCTCATTTTCCGGTTTGCAGGTGAATGCTCTCAAC
CTCTGCGGACTTGGATCTTACATGCGTGGGGCATCATTTTACAGTCCGTTAATTCTACCGGAGGCGACTATGAGCAGTTTGTGAACTCGACCTTTTCGTT
GATGGAGGCCCACGTATTGGCTGGTTTTGTGTACTCCAAGGTCAACAAGCGTGGACAACGGTGGCAAATCAGCACTATAGTTGCGCTTGGAAGGATTATT
AACGATGTGGTGGCAACGCTCGGCCCGGAGCTTGACGGCTCGAACGACCGCTTGAATGAGTTCTACTCTTACTGGatgcttcttcgccaagatggagacg
cgcgtgtggagctgcagttcttgAGGTTCCTGGAGCAAGTCGTTGTGTTTGCACCGTCGCGCTTCCAAGCGGAAGATTTACGCTACATTTTGCGCATCAT
TTCCGATACTGCTCTGCTGAATTCTGGAACTGCATCATCGCTCTCATCGCAACAGACCTCTGGATCTTCAATTTTGTCACCGCCATCAGGAAATGGGCCG
TCTTTGGCTACTTTGGGCAACTTTGAGCCATTTCAAAATGAACTCGTGAGCGTCGGTGTGTATACGAACGGCTGGAGCCGGAGCATCCTGCAAACCGTGG
GTTTGTCGTGCATTCGCACACTGGTGGAGAGAGATCCAACATTAATTCATCGTCAGAATCTGTTTTGCCTGCTGTTCTCGGCACTCCACGTCGAATACAA
CGAGCTGATGTGGGGCTACCTGCCTGGTCTCCATGGTATGTGGGACGTTCTCTCCTTCGCCTTTGCTGATTCTACAACCATGCAGCGAAATAGCATTGCG
GTGCTGCAGAGCGCGGCtctggcgttgctggacgtCGAAGGCAGAGACCACGAGAGCGCCGAGCCGTGTCTCTGGGCTCTATTGTGTCGTAGCATTTCTA
TTGGCGAGTCAGTAAGCACTTTTTCCGGAGGTAATGCGGAGGAACTCATGATGAGCCCGAAAGGAATGATGGCCGGGATTCAGGTACCAAGTTCTGACGC
AGTAGGAGATGACGAGGCGTCTTGGTCACCAAACCCAGCGCTGGATATGCCAAAGACGGATGCAAACTCGCTGGCTTCTGCTGCTATTGCCATTCAAGTG
AGTACGTGGCGAGCTACCAAGGCCAGTGTGGGGGACCTCATGGCATTGATGCCGCCTCTTTCTCGCCAAGTCCGTCATTTCGCAGTGGAATGCGTGCTGC
GAGTTTTTGAGCTGATGGCAGCAACCCCACCAATGACAACTGACATGGGCcagaacaagcagcttcactttGACCTCATAGCGGCAAGACGTTATTTTTT
CGAGATGTTATCCGCTGGGGCAACTTTGCCTGCATCCACCGACCCCAGCGTTGGAAATTTtttgtgcatgtacttggaCGAGTTTGTAACTCTTGCTTGC
CACGTCGCCACGActtctgctgaaggagacgagCTTTTAATGTTCCAGTGCGCGGGACTTCGGCTACTAAATGTGCTGGTGAAGAATTTTGCGTCTGCGC
GTGATCCGGAGGTGGCCACGGGTGATGCTTACTTGTTGGACCCATATCGTGCCCAGCTTTCGTCAGCTATCCGCCATGCTCTGAAGCAGGTCCAAGTGGA
GAGTTCACCGTTGACTACAGGCTTGGACAATGAAAAAAGGGAGGAGGGTTACTTTTACGCACCACTTCTTCTCGAGGCGCACACTATTGCTGGTGCCTGT
ATCTCCGCTCATCTCATCCAAGACAAGGTTGGCTTGGGACGTATCCTGCGAGCAGTTGTCACTCCAGACTATGGCCATGCTCATTTCATTGGAGATGAAC
TTACACGCACTTCACTTTCACTTGCCAACTTGGCTTCAGTGGGAGAACTTTTttcctccagcgtcactgAAGCGATTGCGCAAAAGGATGCACGTGATGA
TGAGCATCGAGCAGTGGCTGTATCTCCGCTGGTCAAGGCGATGATCAACGGCTTATCGGATTCCGCGGAGTACTTGTTTAAGTGCTGGATGGATTCAACC
TTTGCCTATGGCCTTGTGATGCAAGGTTCTGCACAATGGGCACACTTGGacacaagctcaagcgcagcGTTACTGAGTGACGAGGTGATGGTCATGCCAG
CTTTACAAATGCCGCTCCCACCGATTGGTGCCGTTACGAACGTTCCGACAGCCTCGTTGTCCTCcgtcaaggagctgccgGCGCTTTACAAGCGATATTG
GCCCAAGATCGTCCACGCGATGGCAACTTTGGAAGTCTACTTGCCTAAGTTGGTCTCTTTGTGTAGTACACAAGATGGCAACATTCCGAAGTGGTCGTCT
GTCTTGCTGTCAAGTGCGATCTTCCACGTTAACGCAAACGCTCGCGATCGAATGGAGGATGAAGGGGAGCTGCCGGCCGTTCTCCGCAGTATCCCGTTAC
TATTGAGAGCTCTGGCTGAGAACCCGCCTAACCAAGGTGGCTCATCCTGCGATTTCGCGGTGCTCTTGACAGCTGCGCTGAATACGACAATGCTCGCAAG
TAAGCGGTGCTCGGGTCTTGCTCAAACGGAGGCCCTGAAGGCGATGTTCTCCTGCTTATC