Description :
From Genome Similarity Track
Location :
Scaffold_184:80834- 85330
Sequence
4496 bases(100 bases per row)
TCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCC
TCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGA
ACTACCCTGTCCATGACAAGGAGCTCCTGGCATTGAAATATGCCCTTGTGAAGTTCCGTGCTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGA
CCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATAC
AAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGA
TACGCATTGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGAAAGCG
CTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTGTTATCGGGTGGAGCCCACTGTTCCTCCACGGGTAGTCGTACCCAACGACGAGGATCTG
AAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCC
ACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGTGCACTCTTCGGCTCCACTACAGAGCCTGCCCGT
ACCGGCTGGTTATTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCTGACGGACACGGCAACACCGAAATTTTGGTGTTTGTGTGTCGGCTG
AGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACTGTCTCCCAG
AGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAACCGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCA
TCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTT
CCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTC
TTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACA
GGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAAGAA
GGAAGAGGAAACTTAAGTAGATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTTAGCTCTGTCGGCAGCAACAAAC
TGAAGCACCGCTTCATCGGACCTTTTGCAGTTTTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTA
TGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGAGGTTGCTGACTCGCAGTCCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCG
ACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGCTCCATACGAACGAACCCCGGCGCCA
TACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAGCAAAGCCTCGATCCGTC
GGCTCATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACC
CGCAAGACGAGCGATTTCGCCCTGATTCCCGACCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGG
AGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGAAGCACTCGGACGAGAGTGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCAC
CTCCTCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTG
GAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAGCAGAAGCGGCGGCAG
CTTCATAAGTAGTCTGGGGCTTATTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCATGAGCGCTAGAAGCCGCGCGCTTCAG
GATGTCCATTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACAAAGATTACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGT
TCCCATAACTTCGTGGGCGAGTACTTGAGAGTCTCCACCTACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAGCCCAGG
GGTATCCCCAAACAGGATAGAGACCACCCGGGTCTCGGGCTTCTTACGACAAGTCGTAAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGGAGCACACAC
CGAGCAGCCTCCAAGTTGTCGACGAACACCTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAG
CGACGAGGACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGTTGACGGGTGCCGCCAC
CGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCATCCTCATCCTCC
TCCTCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAG
ACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGACCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATT
CTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCGCAAAGCGCACAGAGGTCCTGGGACTGCGATCACCGTGATCACTA
GCGGGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCTCAGAGCCCGCAGGAGCACCATGAGTGCTCTCGGACTCGGCAT
CGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTT
GTCCACAGCCGCGTCGCCCAAGGATTCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCT
TGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGAACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCG
CACAGGTTGCTGCTCGAGGCTCTAACTATGCAGTGAGCCCCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTAAGAATGAGAGTTTGTGACG
AACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTATCCCTAAGTGTACCCTGGTTACATGAAGTGTGA
CACTTCACACTTCAGAAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATT
TCTATAGGTAACTAATAGTTTGTATTAAACCCAAACTTAACCAACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTA
AGTAAAAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCTTGTCACA