Description :
From Genome Similarity Track
Location :
Scaffold_821:8083- 11430
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_821-snap-gene-0.9Leucine-rich repeat-containing protein 56.
Pytve_DAOMBR484maker-pve_contig_821-fgenesh-gene-0.2Heat shock protein, mitochondrial protein import

Sequence
3347 bases(100 bases per row)
TCGTCTCGGGACCAGTCATCTTCGTTGCCGATTCGGAAGGTGGTGGCGAGACGAACTTGCGTGGTGACTCGGTGTCGCTCTCGTTGCGATGACGGCGCAG
CGCGCTGGTGACATTGCCGGCGAACACAATGTCGGTGCCATGGGTCAGATTGCTGCCGGCGTCGTCGGCCAGCGGGTCCTACAACGCACCGAACAAGTCA
GAACAGTCCGGCGTTCACAGATGGTGCACAGAGCGGCGTACGAAAGCTGGTGAGTCGACGTTTCCGATCCTCATCGCGCTGGAAGAGCGAGAAAGCGAAC
GAGAGCTCGTATCGAATCGAGGCGAGCCGAGCCCTCCGTGTTGTCCGGTCAGGTCCGAGGCTGACAACATACTCACTGAGCTCGACGGACTCAATGTTTG
CGTCGAGGCGATATCCACTCGGTTTTGGTGGGATCGGATGGCCTCGTCGACTACCTCGTCCGCGATTTTCGCCCGCTCGCCATCGCAGATGAGTTTGCTG
TCCAGCGTCGACAGCTGCGGCACAAAGTTGGCGACAATTTGTCGGTAGTGATCGATACTGCATACGGAGTTGCCCGACAGACTGAGTGTGGACAACTGGT
GGCAGAAGGCTAGAGCAGGTCGAGTAAGCAACGAGTCCATAGCGACGCGATAGACGAGAATACTCACCGAGTTGCTCGATTTGGCCGACCTCCTCCACGC
AGTTCCCCGTCAAATCTGCCCGATTCAATGCAGCACAAGTGAGGACATGATCGACAGCCAGACTGAGCACGTGAACGCATTTCCGTACCGACGATCTGGA
GCTCGTCGTGCATGCAAAGCGGGCTGATGTCGGCGATGCGGTTGTGCTGGGCGTACAGCTCCCGCAGACACGTGAGCGCGCCAATACCGTCGAGGTCGGT
GATGCCACTGCGTGCGACGGACAGGATCTGCAGCGAGTGCAGCGACGTGCCGAGATCACGGAAGCTGTAGAGCACGCTGTCGTCGAGCGTTAGTTGCTGT
AGCGACGGCAACAGCTCGCCGAGGATCTCCGCTGACTGCTTGCTCACATCCACGCTCATTCGCAGTGTCGTCACGCGGGATAAGTCTTGTCGGCCCGTGA
GTTGTTGCTGCTCAGCACACAGCCAACTGCCGGTCAACTCCCGTTAAACAGCTCATGAACTGGCGCAATACCTACCAGCTTCTCTTCAGTGATATCATCA
AAGGGGTTGTCGAGCTCCTGAACGTCAAGATCGGTGTGGGACGTGCGCTTTCGCCGTGCAGAGGGCGAGAGCAACGCGGAATTGGTGGGGGTTCCAGGCG
TCTGAACCGGCACTGGCGTCGGGTTGCACTCCTTCGGCAGCGTTCGGATGAGGAATTTGGCCTTGCCCTCCATCGCCTGCGGCTTCGGGATCGACAGGCT
TGCCGCTGACTCGTCCATCTCTTCGCGCAGGTCGAGGATGGTGCTCATGGTTCGCGCTGCAGCGGATGGCGAGACGAGGATTCTTGCCGCGGAGAAACCA
CCTTGGCCGCCACCGCCTAAGAGGGTCGCTGCACAGTCACAATCGCGCTGGCGCGACCATCCCGGAATAGTCGGGTTGTTGCAGTGCTCGCGTATTTTTA
GCGATCATCTCCAAGCAATAGTGATCATGTTGAACAAAACGGTGTAGCCATGTTACGACGTAACCAGGGTTACCTTTTGCAAAGATGATGGATCGTACCC
GTAACCAGTAGCCGGTTACGAGTGTAGTTACGCGCTGGATCAAGGTGCGCGACATTTGGCAAAAGAAATGGTGGAGACTGCTGCGAGGACGAGCGGCGGC
GGTGGCGGTGGCCGTGCAGCGGCCCGGAGCCGGAAGCGGAGTGCGGCGACACCTCCACCGCCGGCCGCTGCAGCAGCGAGCGATGTGGCACCGAAGAAAC
CGGAGGCGGCGCTCGTGTTCCTGCGCGTCAAGCGTCGGCGGACCGACACCCCGGTCGAGCGACTCGTGGTGCATCGCGACGAGCCGCTGGCGGCGGAGAA
GTCCGAGGCCGCCGGCGACAAACCTGCATCGCAGAAAGACTTGCTCAATGCGTTCACGAAACTGTCCACCAAGGAAAAGAGGTTCGTTGAGCTGTGTCTA
ACGGATGTGGAAGTTGGTAGCGATGTCTAACCGCGATTTTGGATGATGGTCGAGCAGCAGCTTCGTGTTCAAGCGCATCGACACGATGGAGAACCCGCTA
ACAACCGGTTCGACGCAGTCCAAGTGGACGGAGCGGCTCAAGAAGAAGGCGCGTTCGCTCAAGGACGAGCACACCGAGCTCCGGACTCGGCGGAGCTCGT
CGGCCGCCACGCCATTCCAGAAGACTCCGCTCGCGCCGACATCCAACCGACAGACCACCGAAGCGCGCGCGCTGAAGCAGCAGGACCGCGCAAGAGAACG
GCGGAGGTCTGAGATTCAGCGCTCCCGAGGGTTAGAGGAGTCGGTTATTGAGATCAAGGAGAAGGGGACGGTGGAACTGCCTGGCATCCGACTAGTCGAC
CTGCAGGCGGTGCGAGTGACCAAAGAGAGTGGTGAGGACGGCAAGGCGACTGGTGATGAGTCCACGGCGAAGAGTAGCGCTGCTGCTGTGTCCAGCGAAG
CACTGACGGTGAATGGCGCGCGGTTGCGACCGACGCGAGTGTTGAACCCTGGCGAGCGTGAATTGGACGAATCGATCTGGATGGCGTTCCAGCATAACGA
TTTCAGCCAGTTCTTTGCGATTCTCAACTCTCAGCGACCGGAGATACGCGCGAACCCAGCTACGTTTCAGCGACCAGCTGACGGTGGCTCAGCGCTTATG
GCGGCTGCGCACCACGGTCGCGCAGATGTGATTGAAAAGCTGCTGCAACACTCACCGACGTGTGTGATGCTCCAAGACTGGGAAGGCGCGATGGCTTCAG
TGTTTGCGCGTCGCAACGGCCACTCAAGTGTGGAGAAGGCGTTGGTGGCGTGTGAAGACGCAGAGCGGGACAAGGACTTTGTGTTCGACGTGTATTGCGT
GGATGTGTCCCAAGAGAGCAGCGCCGGCGCGACGGACACCGAGATGAGCGACGAAGATGGTGCGTCGACCGTCGGGCCAGTGGTGACTGTGAGCCCCGCT
GTGCAACTGTGGCTGTCGCAGGATGGCGGTGGTCACGATGAACCTGTCGAAGAGTACATGTTGGAGTCGGACCCCGGTAGCCACGAAGGCAGCGATGCGT
ACGATCTCCTATATAGATATCCCTATGAGCGCTGAATAACTGAGCGATGACACGGCCACTGACGCTGTGTTTGTATTTGATCTGTGCTGCATGCGGATGG
TCGGGACGTTGGATGATCGCGGTGGGGTAGCGAGAGCGTCGACTCGA