Description :
From Genome Similarity Track
Location :
Scaffold_1227:8081- 10851
Transcript NameFunction/comments
Phypl_g12822hypothetical protein

Sequence
2770 bases(100 bases per row)
GGTTGCTTAATCTGCAAGGGCCCGCATTGGGCGAGAGAGTGTCCAGATGCGACCGACGAGCAGAAGCAAGAAGTGCAACAAGCGATGCGGGCTAGGAAGG
CGCGCAATGAGGAGCGAGCCAAGACTGTGCACTACGCACAGTCCGGGCCGGAGAAGGACGTCGAGTTTGTATCAACTGTGTTCTGGATGTACCGTTTTGC
CCAGACACTGGCGCCGACAGCAACATCATCTCACGTGCACTGGTCGAAGAACTTCATGGAGTTAGCGACGCGCGGCTCCAACAACTGGACCCGCCTGTGT
GTGTGCAGGTTGCCGGAGGTGCAAAGGTTTTTTGTCGAGACACTGCGACGTTGGATTTGCGGGTTGAGACTGCAGCTGGGCCGCTGCATCTTTCGAGCGT
CTCGTGCCTTGTCATGGACAGGAACGAGGATGAATTTTTGCTCGGCCGCACGACGATGCAGGACATCGGCATTGATATTGACCGATTGTTCGAGCAATTA
GCAGGTGGTAACAAGGTGAGTGACGCCGATGAGAACGACATCACTAGTGAAACACCTCAACTGGTGTTCACGGTGGATAAGGAGCAGATCGAGGCGTACC
TCAACAAGATGTTGGAAGCCGCGAAAGCTGCGGGTTTTGAACCTGCACTGTTGGGTAAGCTGCGAGCTTTGGTGTTCGAGTTTATTGATGTCTGGCGCAT
TAACATTGGTGCCGACCCACCTGCcgacgtggagccgctgaagGTAAAGCTACATGACGATGCGAAGCCGTATCGCAGTGGCACTCGGAAATACCCCGAG
CTACAGCGAGTGTTCCTGAGAGATTTTGTGCGTGAGTTGGAGCGCAATGGTCTCGTACGTCGCAACAACTCCAGCCACTGGGCTTGCCCGGCACTGCCTG
TCAAGAAACTCCACAGTGACGACTATCGCTGCACGATCGACTACCGTTCTGTGAACAAGTGCACAGTGCCGCTAGCTGGGGCGACGCCGAACCTGTACGC
AGTGACACAGAGTGTCAAGGATGCGTACGGCTTTGGTCTGTTCGACCTTTTCAAAGGTTTTTGGCAGTTGCCGTTAGATCCAGCGAGTCAAGAACTTTTC
AGCTTTGTCACGGAGGACGGCGTATTCACGCCAACGAGGGTTCCGCAAGGGACCAGTGATTCTGCGATGCACTTCCAGCTGCAAATGCAGGAGTGTTTTC
GTGACATGCTCTATCACAACCTCTTAGTGTGGATTGACGATCTGCTGTTATTTGCTAAGAGCGCTAGCGAGTACATCGCCAAGCTACGTGAACTGTTAAC
TGTGCTCCGTGCCCGCCGACTCAAGTTGAACGCGAAGAAGTGTGTTATTTTCGACTCGGAGGTGGTGTGGTGCGGCAAGGTTATTGATGGCACTGGCATC
AAGCATTCCCCGGGTCGACTGCAAGCATTGACAAGCATGCAACTGCCACCTACTGCGGCCGCATTGCAGCAGTTTCTGTGTGCAGCCAACTGGCTACGCG
ACTCGATGGTCGACTACGCACGCGTTGTAGGACCGCTTCAGTCTAAGCTCGAGGGTGTTATCGCGCGCCGGGGTCGGCGCAAGTCGCAGCTTGCGGGTGT
GGATCTCAGCTGGCCACAGGAGGATATGGACGCTTTTGAGGCTgtggtcaagctgctggcgattTCGGCGAAGCAGTACTTTGCCGACAGGGACGCCACG
GTGTGCGTGTTGAACGACGCATCGCTAGCAGGTTGGTCAGCTATTCTCACGCAAGTGCACAACTGGGTTGATGGTATACCAGtcgcggagcagcaacaTG
AACTATTGGTCTGTCGTGGCGGACTTTTCACCATAGAGAGAACTGGTCTATCGTGGAAAAAGAGGCCTATCCGGTGGTCCGTGCCTGTAGTGATCTTGCC
TACCTACTGGAGCGCCAGAAGGGTGTCCGCATTTACTGCGACCACGCGAATCTGATCCACATCTTCGCACCTGACAAGACGATTAAGCCGCACTTGCGCG
GCAAGTTGCAGTGGTGGGCACTGCAAATTGTGGGTGTACGATACACTATTGAGCACATCAAGGGCGAGGACAACGTCTGGGCTAACCTCGTCTCGCGCTG
GGGCCAGAGCGGGACGTCTCCGCAGGACTCTTGCCTGGCCGTGAGGCGAGTGattggtgctgcagctggtgatGGCAACGGCGATCCTGAAGGCGAGGCG
GATGCCCCAGGGGCTGCTTCTCCATTCTTCCAGCCTGTCGATGTCTCTGCTGCGTACCTGCAGCTGCCGATGATTACAGCAACGGCAGACATCCTGACGC
CGGTGAAGCGGGTGACTACACGCAGTTCACGATTAGTCTCGTCGCTGCGTCCACTGCAGGATGACGACTTTGCCTGGCCAACGATGGTGGCGATCGGcgt
ccagcaacgccaggCGCACGCAGATGCATCTAGTGCTGCCGACGCGGATGGATATGTCCGAGTGGACAGCAAGCTGTGGATTCCGCGGCAGGCGCGTGAG
CTCCTGCCGCGGCTGTTGGTGGTTGCTCACTGTGGGCCGCAAGGACATcgcggcagcgacgtcatgCTCGCATCACTTACGGAGCGCTTTGCTATCGCGA
ACCTGAGGCCGCTGGTTACGCGACTGCCTTCTATGCAAACATGTCAAAGGTGGCAAAAGCGTCGTGCGCCCATGGGGTCCGACTTCTACTGGTACGAAGC
GGAATGAGTGCCTCCACCTGGACTATTTGACCCTCGGCGACTCTTATGGAGACAGCAAGCACGTGTTGGT