Description :
From Genome Similarity Track
Location :
scaffold_956:8080- 9227
Transcript NameFunction/comments
g10697.t1hypothetical protein

Sequence
1147 bases(100 bases per row)
GCGAAGGACGCCCAGTCCTGTGCGAAGATCGCTGACTTGTACGAGGTAGATGACGATGGACTCCTGTTGTATTGCCCGATCTCCACGTCCAAGTCGGACA
AAGATCGCGACACGACCGCAAAGCTGGTGATCCCCGAACTGTAGCGTCTAGACTTCCTGCACTACTATCATACGAGCATGGAAGGCGGGCATCAGGGGAT
CGGAAGAACTTATGCGCGGATCAAGCAGCACTTCCACTGGAGGGGCCTGTTCCGAGATGTCCAGAGATACGTGGGTGAGTGTGTTGACTGCGAGACTGGG
AAAGGAAGACCTACCATTCAAGGAAGATCGCCCGGGAACCTGCAGGCCACTTACCCGTTCCAGATCATCGCTATGGATCACATCCCCTCGCTCCCGAAGT
CATACAAGGGGAACACGGAACTCTTGATCTGGGTGGATCTGTTCACAGGGTACGTGCTGGCGAAAGCGAGCGGCGCCCGGACCGTGCAACAGATCGCCGA
GAGCTATGAGGAGAGTGTCTTCCGTCGTTTCGGAGCGAGCGAAGCCATCCGACACAATCGCGAGCCCGGGTTCATGGCAGATGTCTTCCGTGCGTTCAAT
CGTATTGTGGGTCACCGGCAAAGCCCGACAGTGGCTTATCGTCCTCAGGCCAATGGGACAGCAGAACGCATGGTGCAGACGCTGACTCGATCAGTCAAGA
TGTACGTCGCAGACATCAACCAGAAGGACTGGGACGAGTATGCCGAGCGGCTGACGTTCGCGCTTAACACGGCACAAGATCGAGTTCGGGGTGATACGCC
GTTCTTCCTTGTCCATAGTTGGGACCCGCGATCCACTCTGGAAGCAACGTTGCCTGTGGGAAGCACGCGTCGCAGAGATCGCGATCCGCGGAGATGGCGT
AACCATGTGCAGAGCCACTACCAGCGAGCTCGTGAGGAAGTGAACGAACGCCTACGCGAAGCCATCCGCGGACGAGCTGATCATCACAACGAAGATCTTC
GTCCACACCACATCGAGGCCGGAGATCAAGTCTGGCTGTATCTGGACCGCGTCAAGGTTGGCTATGCTCGGAAGCTTGCGCACCTCTGGCATGGACCATT
CCGTGTTGCTGAGATGATCGACCAACATGCTGCGAAGCTGGAGATCG