Description :
From Genome Similarity Track
Location :
Scaffold_1057:808- 12561
Transcript NameFunction/comments
Phypl_g12204hypothetical protein
Phypl_g12205hypothetical protein PHYSODRAFT_561505
Phypl_g12206hypothetical protein
Phypl_g12207hypothetical protein PHYSODRAFT_302198

Sequence
11753 bases(100 bases per row)
AAATACCAAGTTTGTTTAGCTCGGGAACGCGAATGCCACGTACATATAAGTTTTCTACCCTCGCTTCAGCACAACACACTACAGTTCATTTTTACAAATA
CGTTTGGAACAAGCCGGTTGGGTTTACTttcgcagcagcgatgatcttgaggacgacgacgaagtaGAAGCCGTGGAAGCTGACGACCTCGGAGGTCCCG
CAGTGCCGTTAGACTGGCCAGGTTGCTCCTCGAAGCCGTGATGGGTCACCATAAATTCCGAGAATGCCTGCGTCGCGATGAAAAGTGTTCGGAACTCACG
CATCCCAGGCGTGGAGGCTGCAAGGTAGCTAgcctcgtcgaagaagacggtgcGCTTGCGAGCAAATTCGTCCGTCCAAACGTAGCGGTGGTACCCGAAG
TCGCCAATGAGCTTGTTGACAGCTCGGAGGAAAAGTCCGCGGACAGCGACCTCCGGAAAGACTAGAGGCTTGCTCGGGAAGTGGTGAGCAAACACATGAT
CACTACGGCTCACGTTCGGCTTGAGGCACTCATAAAGCGCATCACGCAGATCAAACCGCACGCTGTCAGGAAGCGCACAGGGCACTTCTCCACGTAGAAC
GGCTCCCTTGTCCAAATCCACAACTAACAGCTCCTCACCAGCCCCGTCAAAAAGATCATCACCACCTTCCTCAATGAGTTGGCGTTGGGCATCGTCGAGC
GCTTGCTTCTCCGCACCAAAGATGAAGGGGGTCGGACACTCGAGGTACTGCAGCATTCGTCGGGGAAGCACGGGGAGATACACGTGCGGCCAGGACAGCG
GATGCATGAGAGCTCGCAGCGACTCGCTGACCTTCATGAGCACCGACAAGTATGACGACACTAACAGAATGCggttctccagcaacgctgCGGTAAATAC
AAGAAGCACTGTGGAAACGTCCAACGTGTCAAACAATAGGCGCACTGAGTGGTCCAGTCGCGGAAGCGCTGCAAGTAACGAGACGGCCGTGGCCTTAGGC
GTCAAGCCTGAGGACTCGAGAAGCGGTGACCCCGGAAGCGGTGACGGTTGGTGGTACTGTGAGATGTGCTCCTTTGAGACGGAGCGGGTCAACTTGGCAA
GGACCTTCTTGTCAAGCTGAAAGCCATGCCCACCATTATGAAGCACACCTTTGTCGTCGCTtttggcagcagctgcagcagcgatagTCTCAAGCTCTAG
AATGAATTCGTAAGCTTCCGCAAGGCGCTCTCGGAGTAGATCCACCATTGGAAACTTCGACAGCACGCACACTCCATAAGGCACCCATCGACACCCACTG
ATTGAATCTATCCGTGATGCCTCGAGTGCGCGCCGAGACAGTGGGGGTGCTGGCTTATACAAAACCACACAAGCTGCAAATAATTCAGCAGCCGAGGCGC
CTGCACTGCTGTCACCCATGCGGAAGTTAAACGCCAAAGGTGCTGGGCAGGACGGTGCCGTAAGCACTACTTGCCTAGGATCCGAACTCCAAGGGACGAG
GAAGTTCTCGACAGATTTGTCCACGACGTGAGGTGTCGGGTCATGTGGCAACGGATGTTGTACTACCTGCAGTTCAATCAGGTCTTCGAACACACCACTG
CCATTTTCGTCAGTGCCATTTTCCACTGCTTCGGCTGTCGTGGGCACGGATACAGCTTCAAATGTGAGTACACCCGAGATTGCTTCAAAACTCCGCGCAG
TACGAAGTGAGTCGAGGGTCTTCTTTTTTGGTGCTGCGGTCTCAGCATCGCGGAAGctagacgacgacgatgacgttGACCCGTTAGATGACGAGGAGCC
CGAACTACCACCAGCCCAATGGTGCGCACGCAAGCCGTAGCTcaggagcagcgccgagagtCGCATGGAATCGTCGATGGAGTCCTTCTCATCTTCAGGT
GAAAGCTTCGGGTACAACGCAAACTCAGCGTAAGCACGACTCGTTAGGAAGCGATGATACAGCTCCAGGTGAATGAGGCTAAACTTGGTCAAAATCGCGT
CTTGTTCAGCTTGGAGCCGAGAACACGACGTCACCAGCGTGCGCGACAGTGTCTGCATCTCAGCGTCCCCAGCGTAATATTTTTGTGAGATGTACTTGAG
CAACCTCCTGCAGCGATAAGCAGCCTGCTCTATGCGCTCACGACGCTGGTtgctggtcgtgctgcttgatgaaGCGACACTTCTGGAACTGCCACTAGAC
TTGAGCAACGACATATAAATGCGGAACGCTGGCTTGAACTCATATTCAACGTCCAGCCATAGTGCAATTTCGCGATGGTAGTTGTGCGGGAACAGGAAGA
TCCAGAAGAAGTTCGCAAAACGGTGGTTCATCAAGATATCCTCGAGGCATATGACTTCACGCTCCACGGTCTTCTGCATTTCAGTGTAGAGCTCCGTTTT
GCGGAAGTCAGGGAACTTGAACATTAGCACCCGTTTCACCTTCACGGCAACGTCGTCAAAAGTGCGTAACGCATCTTCACCTCCGGCCGCCAGATCACGT
TTAATGCAGCGTAGCTTATTGGAGTCCACGATTGGAGGCTCGTCACTTCCATCCTCAGCATCGGCAGACCCATTTATTGGGAATTGCGCGTTTTTCGCCA
GATATTTCATCGCAATCTTGACGCCATACGTGCGTAACATGAGCACGTCATCCTTCGCAAAAGGTTTCTTCTGGTAGTTAACGCGCAAAGTACACCAAAA
CTGCCGGTACTCTTCAAACGAGCAGAGGAAGAACAATTTACTCTGGTCTGCAGGATCGGGGAGCCATGCAGCGTAGTAGCGCATCATTCGCGGGTTGCTA
ATAACTTCCTCAATAGAAATAAGTGTAGTCGGATCTGGAGTTGGTTGGTGCGTTGGGAACGCAaattgctgtcgctgccgctgcagtaCCTCATCCTTGA
AGGCGCGCTGCATTACTTTACCGAAATTGTGCTGATACTGGTCGTGCATCCATCGATTCCACTTCTGGAGCTTGGCACCACCATTAGACGCCGGCCCAAA
TGATGGCAGTGGGGGTAATATTGAGTGGTGGTGCgttgatgatgatgacgcGGATGACGAGGCGCCTGACGTAGCCCCAAAACCACTGCCACTGCTCATT
TGCGCCAGAATTTGCTTCTGTTTGTTCGCCCAAATCTCTGCTGACGTTGGCGTTGTAGAAGTCACCGCGCcattgctgccgtcgccagctgcagaagccC
CATTTTTGTTGCCCGCCACTGTAGAGTAGAGAAAGCTTCGCGCCTTCAGCTTGACGTGCTGTGCCCACCGAGACTTGGCGTTTTCAAGCTTAACAccctc
ctcttcctcctttATGCTGGTGACTTCATAGCTATTGACATCTTCATCCGACCCACTCAGTACCTCTGAGAGTTCCCGTACGCTCAGCTCCCGTTCCGGT
TCAAAGAGATCCGTCTCATACAGCATTTGCTCCGATATCGTACTCCTCCGAAAGGTACTACGACTCGAAAACGAAAACGCCAAACTATCGCGGGAATGCC
TCGACATGGCCAGCGAGTCTCGCTCATTGACCAAATTCCCACCCACAGCAGTCGACCGTCGTTGATGCGGCAATAAAAACTCGTCCTTGTCAGTATACAA
CGACGAGCTCAGTGCACTCGCCATACTCTCCCGAATCACCTCCTCCGCCGATATCGTGCTATCCGGTGGTAATGGCGGACTCGAATCCAACGACGCTAAC
AAcaaaaaacaacaacaaataAATAGAAACAATCAGTCCCAGTCCCCCACCCACTTCTCTCTCTCCTCTCTCTGCAACGTACAAGCTCTTCTGTATCTCT
cagcgccgctgctccttctACCAGAGGTTGAGTCTCCCAGCATATTTCTGGTCAGTCTCCCGCCGTCAGACACTGCGTCTTCCTCATCGAAGCTCAAGGC
TCTGGCCGCTAGTGCGTGGGCGTCCACCGACTGCCTGGCCGCGTCGATGTCCATCATCAGGAAGCTGGCGTGGCTGCGTAGAGCCGACGAAGAGACCGGA
ACGCCTGCGCCGGCGCGGAAGCTCGAACCGGCGCTGTTCAACCggaacgaggagctcagGCCGCCGCTCTGGCTGAACGGACTGTAGCCCGAGCGGCTga
gccgccgcccagcgcccACCACGTGGTCTGCCGATGCGCTGCGTTTGAGCTCCATGACGTcgctgggcagcagcgtgcgctctccgctgctgctgctggc
gccggcgGTGGAGACTGCAGCCGAATCGGCGGAGCTActggcgtcggcggccgaCGCGGGAACGGGCGTGGTgaggacggcgccgctgctgcgactgcgc
cGCCGGGGGCGCGTGCGGATGTTGGCgcgctcgaagtcgtcgctcatggcgAAAGCGCAGGACGGAGCGATCGAGGGGTGGAGCGCTGCCCAATACCAGC
GCGGCTCTGCTTTGGGGATGTGTCTTCCTGCAACGAGATCGCACCTAAGTGGGACTATTTtggtgtacatgtacacgacCATTAGTTGATGTGGTGCACA
ATCTGAGTAGCATTTCTGATACGCACGTTCTCTCAGTTTCAAAGAGATCTCTCGTCACGTAGCTGCTgagcgctggagctgtctGCGTGCTGAACGATGA
GTGAGCGTCGAGTGAACGCCGCGCAGGACGCGGTcatcaaggtgctggtgctgggcgacgccgccacggGCAAGACGAGCATCATCAAGCGGTGCGTGGT
GTAACAGTAGTCGATTGCCGTCAAACAGACAGGAGGGGGGCGCTGACGGTTGTtctcgctgcttgctgcctGGCAGATACGTGCACGACGCCTTTTCGGA
GCACCACCGCACGACGATCGGCGTGGACTTCGCACTCAAGGCGGTGACGGTGAGCGGCACGAcggtgcgtctgcagctctgGGACATCGCCGGCCAGGAG
CATTTCCGCGCTCTCAACCGAGTCTACTacaaggacgcgctgggggcgctgctggtgtacGACATGTCTCGCCCGGAGACGTTTGACAGCATTCTGAAGG
TAgggagaggaggaggcttGTGTTGCTAGTGAGACTGTCGTGCTTACATTTGGTATGATGGCGATGCAGtggaagaaggagatcgacTCCAAGGTGGAGC
TCCCCAATGGCAAAGCGCTGCCCGTCATTTTGTGTGGCAACAAGGTGGGTTGCTCTTCTTTTAAGCTGAAGTTTGGAGTCCGTGGAGGTGCTGATTATTG
TTTTGTGGTGATTGTTGCAGTGCGACCTGAAGGAGGAGGTAGACCGggacttcctggacgagttctGCAAAACGAACAATTTTACGGGCTGGTTCGACAC
ATCCGCTAAGGAGAACATCCACATTGATGATGCTGCGAAGGCGTTGGTGACGGGCATCCTGGAGCATCAGGACATTTTCGAGCGGAAGTCAGAAGCGAAG
AAGCGTAACGATACCTTCCGTCCGACAAGTGCTACCAACGGAGGCAATGCTAACCAATccagctggtgctgcaacAGCTTCTAACCTCCACCTTTCCGAT
AGCTGCAACAGAAGTACTCCCGactcgacgcagcagaagacgatGTTTTTAGGTCATGTCGATGCATATCATGCTTGGGATGGGGACAGCGTTAATCTGA
CTTTGAGTTCCCACAACCACTTCGTTTTCGCTTCCATTTTGCTGTGGTTCGCCAGCAATTTGAGACTTCTATCTATGATACTGCCTTTCCTACTCGTCCG
AGTCTGCGAGACGCCGctttttgctgcttcctgATGCTTCCGAGCGCCGGGACTTGGTGAAGTGCACTGGGAGTCGACGGCTATGCGAGGTAGAAATGCC
ACGGTGTTCCATGCTTCTGCGCACCTTACGGATGTTACTCcgtgcagcgccgagttTCTCCAGCAATTCTTGCTTGTTAGCCTCTGCTTGGTCTAACTCA
TCCTCCAGCTGGATCACCTCCTGCTCTCGCTCGTCGGGACGATGGTTTGTGAAAGAGGCCGTAATATCGTTGATAATCTTCTGCACTTTCGCTTCAGCCT
CTGGTTGCTCCGCCTCCATGAAATCCACGGAGCGGATCAGCTGGCGCTCTTCCATTCGCAGGCAGTACTCACAAGACTCACTTTCGTCCCGGGCTTTACA
TTGTGACAGATGCGCAAAGTGGTGCTCCACTGCTCCGCACATTGGCTGATGGCACACCTGTAGATCCAGGTGATGCTGCAGGTGATCAAGAATGGACTTG
CAATTAAGTAAGCACCGTTGTGCTTTGGAAGGGGCGCAAAATGACGCGTCCACAATGGCATAGCCCAGCTCCATGATCCCATCAAACTCCCGCTGTGCCA
TCTCTCTGTTATCCCCGCTTTCTGTCTTGGCCCGTAGTAGTTGGTTGATGAAATTCGCATTGAAGTTCGAGGTTCCTGGAATACTGTCCTCTTCTGTGTC
CTGCGACTGTGACTGTTGGCCACTTGCTTCGTCATCTATGACCCATACAAAAGAGCTGGTAAACGTATGGAAACCTCGCAGATTAATCAACCCCAACTCT
TGCCTACCTGGAGTGAAGCTGTTGTCACGTTCTTCGTGAATCTCAGACGAAGGTTCGGCCCCTTGATCCATTTGGATATCATGTCTTGCTGATTCAGCTG
CAGATTGTCCATTGGTAGTGTCTTCGTTCACTTCCAAAGGTGCTGGTTCTCGCTTGATAAACACATTATCACTGAGGTGCCATTGGTACTTCGAGAAATT
AAAGACCGGAGCACTGCTTTCTCTGGCCAGTTGGTTGAGTCTGTCAGTCTCCGCGCGAAGGGGCTGCTTACGCTCAGTCCACCTGTTGATGCTCTGCAAA
CAGAAGTTGCGGGCTGCTTCGCTGTGCGCGCCTTGAAGCGCGCGACGCTGGTCACAAATTAGGTTatccagcgctgcagatACGCCAAGGCTCCGTCTTT
GCCGAATTCGAATGCAAAACGGGCACACGAACTTTTTGCCATCAATCGTAGGCGCAGTGTCTTTCTTCAAGCAAGTACGCCGGTGCCTGTATATGATTGA
TATCTCGGAACACTTGGGGTCGCCACACATTTCGTCGCGCTTACAATGCTCGTAGTGCAGGATCACAGAACGACACGCCCGCTCTTCACACTTCCCAATC
CTTGCGCATATGAGTGCATCCTCGATGACAAGAGCATCTTCGATTCGCTTTGCCAGCATCTCCATCAGCACGTGGTCAGTTGTGGGGAACCAGCGCAGTA
GCTTTTCCAAATCTACGGGTTTGGACTGTGATGTCGACCTCGAGGTCCGCTCAGTGCTcggctgcactgcagcggTAActggagcggcagcaggcggaGG
CGTTTTCGTTTGAGGGacagaagctgaagctgatgaagctggTATAGGAGTTGGAGcggaagatgctggagaagaaacAGAGGCAGGAGCAGTTGAAGAT
GTGGCTGATACAGGACTCGAACCTTGAGCTAGCACAGGCGCCAGAAAAGAAGCTGGATTAGTCGTCGCAGATGAAGCTTGCGCTTGAACGTGAACTGACG
TCTTGATCGCGggagcagaagctggtaCTGTTGAAGTTGGTGCAGAGGATGGTGGCTTGTTCTTCTCTTGGTTTTCACTCGATTCACTCTGCTGGTCTGT
AGCTGCACCCTCCGTTGTGAAATTCGATTCTAGTACAGAACTTAGATTTGTCACTGGTACCTCTTCGCTTGGAGCATCGTTCGCCTTCTCTTCCAGTTCA
TCCCCCTGTTCAACGCTCATcgcgtctccatcttctccattGTCTACTGACTCGCCCACCACTTCAAACTCATACTCTCCTTCTATCAacttgtcctcct
tctcctcttgtTTTGTGTCCTCTTGTTCACACTTGTATTCCTTAGCGGGGGCTGGAGCCTCTGGCTTGTCGCCCTCCACCTTCAGGTTTTCGTCCTTCTC
CGTAGCTGCTGCCTTCACGGCATCTTCCACGCCACTAGCAACGACTTCCTGAGCTCGAGATCCATCAGCGACTTCGTTGCCGCATCCATTTGCAGAGAGT
TTTGTATACATTGCAGCGGTGCTGATACCATTGGCGACGCCGTCCTGGCGCGGGGGCCCCCAGGCGAGAAAGGAGCGCGTCTCGCCGTAGCAGGTCGTGA
GCTGGTGGCTGCGCGCGAATCCGCGCGAGTGCCACAGCAAGGAGCAGTTGGAGCAGAGCGTCTTCTCCTGGCGCGGGTCGCACGCCGAGCATTTGTACTG
CCAGCGCGCCGCACGGCACCAGCTACACAAGCTGTCCATGTCGACCGCGACAATCTTTGCTGCGAAATTCACGTTTGGAAGATTAACATTTGGGGCGAAT
ATCGCAGAACAAAGTGCCAATAGCGAACGCATGAGCTTTACGTATGACGAAGACAGACCGGGCCGAGCCTCGGCTGTGCATGCAAGGGGAGATCTTCAGG
ACACGCCACCAGGGGAGAAGTGGTGTACGGTGTTGGCTGAGCGTGGTGAAAGGCTCATGAGAAGGGGGAAAGCGCAGCAGATGATCAAGATGAGTCATTA
GTATTTTGATGGTTCAGGGTTGAAACCACGCGGCCAGACGTGGAAGGCCTGCTACAACTTGCCCCCTTCCTCCCTGCATGTCAGCTCAAAGACATAAGAG
AAGCGGAGAAGACACCGGAAGACAACCAACACAAGCCCCTGACTCAGCACGAAAAACAAACCAAACTGAGATTATCACTAGCTTGCACTTTCCTGCTGCT
TACCGagtgtcctcgctctccaCATCCTCgctcgcacagcagcaactaaGCAGCACTACGTCAGCTAGAACGATCTAGCCGATGCGTAGCTAAAGCTGGC
CGGCTGCCGACCACGGGGACAGGCCGAAGATCTCCTACTCCTAGCGTGCTCTAAGTGGCGTACTTGGCGGTCCACTCACgggcggtggcgtcgtgACGCG
CGCGGTCTGTTCTATAAATTTGCGCGATCTCGGGCACCAGCGGGTCGTCCGGGTTGgcgtccgtgagcagcgagcagatcgacagcagcaccttggagAT
GGTCAGTGCGGGGCTCCACTGGTCCTTCAGGATGTCCAGGCAGATGCCGCCGTTGGCGTTGATGTTGCAGTGGTAGATGCGCGTCGTGAAGTTCACCTTG
GGCGGCTTGAACGGGTAGTCGGCCGGGAAGTAAATGTTCAGGAAGTACACGCCGCCGGCGTACGGGCTGTCCTCGGGGCCCATGATGGTCGCCTGCCAGT
GGAACAGGTCGTCGCCCACGGggccggcgctgcagttggcgGGCGGGTCGCGGCCcaggtcctgcagctccttgttgaTCCGCTTCAGAGCCATGCTTGA
ttctgctcctcctctcTCTGCTTCGACtccgctctgctgctgcttcctgctTCGAAAGGAAAGTGATAGCAAGGCTACGCGGCCACGAGGAGCGAGGGGG
AGAAAGCTCGCGTGACCCCTATGCGGCAACCGATCGCAACGTCACTTGTAAACGGTATATCAGTTGCGCAATCGGGGCCTTCTGGAAGTTTTTCTTCGGT
TGCGGAGAACAGGTCGAGGCCCTCGCACTTAGCCAGATTCGGATCACGATTGGTCAAAACGCCGGACATACAGCGTGGCGATTGGTGGAAAGTTAGCGTC
CAGCTGAACAGCCTTCTTGGCGACTTGCTGGCAGCGTGATCTTGCAGCGCTGGGTTGCCGCAATGAAGGGGCTTCGGTGGGCCCTCATTGAACACCCTGC
TCGCGAAGAAAGCAGTGTGCTGCTTTACGGACCACTAGTCGCACTACGGTACGGCGTTTCGTAGGGTAAATGCTCGCAGGCCTCGAGCATTAGGCGCCAA
ACAGCGAAATTCGGGTTCAGTCCAGCGATCCGAGCGTCTTGATATAGACGATCGAACCCGAACCAGATCAGCGAATTAACCAGCATCGCTTTGGCCGGCG
TCGGTCACTGCCGGACGTCGCTTTCTCACTTCTGCTacttgctggtgccgccgtcgtccCGCGAGGTATCTCTGGCGATGGCACGACGGCAGGGACAGCC
TCGGCGCCGACGTTGCCCcgagctacatgtacatgttcTGATCGCCTCGAAAGTAGGCGTCGCCCGTTTGATCGTCagccgcgagcagcagcgctgccac
gTGACGGTCCTCGGCAGCGTCCGGATAAGTCTCACGACCCACCAACTGTCGTGCACGTCAATCAATCCCTTCAACATGATCCCGTCGGCGTTGACCACCT
GCTGCCAATACAATAAGTGTCCGACCAGCTGGCGCAGGGAATGTAATGGCGCTTGCAGCATTGCATCGGGTTGGCACACATGAAACGACGAGGCTGCGCC
GACACCCCTATCAATGCGGCTCCAATGTGCATGATAGTATCATGCACTTTGGAGCATTGCGCCGCCCCAAAGCCACAAGCCGATTTTTTCAGCGACTTTA
CCCGCTTGTCGTCGCGCCGTGTGTAACAACTGCCGACTCAAACACCTTTCTACTGTTTTACATGTGCATATGTTTGCTGTTCAAAGCAACTCTTGTGTTT
GATATTCACATCAAACCCTCCCATCCAGCATCGGTTTGATATGCTCTTCCGCAGGTGCGGCACCGCCTCATGCTTTGCAGGGCTAAACTGGCTGGATTGC
GTCGCCGTCACTCTCGTTCTTGCGCCtccgacggcgtcgcgctcggcctcctgTCTTCTAGTCTGCAAGCTCCTTCTCCTAGGCGGCCATGGGCGACCGG
TACCGCAGCGCGCAGTCCCCGCgcaacagcggcggcggcggcgtgacGGAGGAGCGCTTCGGCAAGCTCGTGACGGAGACCAGCAAGGGCATCTCGTGCT
TCAACCAGCTCACGCGCAGCATCGCGCAGAAGATGTCGCTCTTCGGCACGCCGCAGGACTCGCGCGCCAACCACAACcagatcaaggagctcacggagaa
gggcaacaagctcgtggccaagatcaaccgccgcctgcaggagctcaaCCGCGGGGCCAAGGGCGCCGCCGGCCGATCGAGACGCACGCAGGTCAACAAG
CTCTCGGCGGACTTTAAGAACCAGATGCGCGCGTTCGAGGAGACGTGCGAGCGGCTGCTCGAGTCGGAGCGGCAGTCGGTCGAGTTCATCCGCCGCTCCT
CGCAGAGCTTCaagggcggcgacggccgccagacgcgcggcggcgccgagtTCACCAACTACAGCGAGGACCAGATCTACGCACAGGCCAACGTGGTCAT
CTACGATGAAGACGgtgcgttgctggtgctggtgctgtagTGGCGCAGTCAGGGGCGTTGTCTGACTGATGCTGTCGTGATGTTTGGCTGAACAGACCTA
CAGAGGCGAGAGGATGACATTATCCAGATCAaccaccagctgcgcgaggtgaACGCTGCCTTCCAGGAGATCGACGGGCTCGTGCAGGACCAGGGAgaga
tggtggtggagatcgtggacaacACAGAGACAGCCAAGGATAACGTGGAGAAGGCACTGGAACAGGTGAAGCAAGCagacgagcgcaagaagtGCTGCGC
ATGCTCACGGATGAAGCTCATTTGCCTCGCcatcttcgcgctgctcatcttcatcgccCTGATGGGCATCATTTTTGCCGCTAAGTGATCAACTGTATTA
GGATTTAGGGATTTCGTCTCTTTGGCCAGCCTGACTTCGTCTTGTGGATGTACTGTAAAGCAACTGTGAGTGGCAGTCGCGCTCAGCAGAGAATGACAAG
GAAGCATTAGAGGCCGGTTTATTCTAATAGTAAGTGGCTGTATAGCATTGTGG