Description :
From Genome Similarity Track
Location :
Scaffold_29:807883- 812880
Transcript NameFunction/comments
Phyin_T30-4PITG_13537Secreted RxLR effector peptide protein%2C putative

Sequence
4997 bases(100 bases per row)
CTCTGCAGGTTTACTCCTCTATCGCCTGATCGTCTGAGCCATATGGAGTAGGATGAGTTTAAATAGGGTATAGTTACAAGTTGCTTGTGATTGCATCAAG
ATGTGGATATAATGTGTAAAGTCACCGTTCGACACAAACACACAAACTCCATTCAAACTCCACCAAGGATCAATCCTTTGAGTTTCCACATTTGAGAGAA
TCGCCATAATTTAGAAAAGTACTCCGATTCACTAAAAAAAAACACCGTCTCTGAGTTATTAAGCTCATATCCAGACCTTGAAGCACCAAGTCACTTCGTG
AACAAGGCCTTCGCGGCATTACATTGACGTTGGCATGGACCGAGGCCAGCCTAGAATTTATTCAGTAACAGGTACTTCACTGTAAAGTTAGTATTTTGAA
GTAGCTGTTCGGTTGGTGTAGGAACTGAAGGCATCAGCTAGTAAACGGTCTCTAAATAAATCCCTGTTTGAGCGATACTAGGATTGAATACGCCGGAGGT
TAATGGGTTACAGTGCTAGCGAAAAGCGACCAGAAGTACTTAACAATGTGGTTTGCTTTTGACAGCCGGTGTCTAGTCAGCTGTAGCCTAAAAAAAGACA
AGTACGAAGTACAACACACAACCAGCCTTATTAGTTATGGACATTGAAGAGACCATATAGATGACATAAACGGCCATTTGATTTTGATCTACTTAGAAAC
ATGAACTGCACGTTGCTGCGTTTCAAACGATGCTTTGACCAATCAACCAAGTGCATATTTTCTAAACTGCACGTTGCTGCGTTACAAACGGCACAAACAA
TACTTTGAGCCACAAATCGAGGCTCAATTAATGGACATCTCTATATTTTATCTCGCCTGGCAGCTCAATTTGCTCTATTTGAGCAGTCGACCGAGATAGT
GGTTAGATGCTTTACAGTAAACGTGATTATGTATGACCACCATACATGATTATGAGCACCATAATCATGTAAAAAACGTCGTTTGCTCGAGCTCGAGTCG
CTGCCAGCGAGTCACTGTGTGTCCATATCCTTCTGCTCCTGGCGGTACAGACGCGCCAATTCGTCTCTCAAGTGTCGTAGGTTACGCTGGGTCACCCAAC
CTGGGTGTGGGCCAGTCACTGGGAAAGCGCGGCTTTGCTGTGTCCCGAGTAGGCGGCATGATGAAGAGGAGGACAGACGAGGCTTTGTTTCTGGTCGTTG
GAAGGGTCATTTGGGCCAAATTTTGGCGAGGAGCGGGACTGCTTGGGCGAGCGCGCACGGGGTGACTTGATATACTGTACTCTATGTTCGTGCGTGGAGT
TGCTTTTTAAATTCTGATAGGCGAGATTTATTGTCTTTTCGGGCGTTATGATATCGACATGACAGAAAGTTAGTGAATGCTCTTTTTAGAAACAGCGGAA
AGTATTGCTTTTTTCTTACATAAAACACGACATTTTTAGATCAAATATCGTACTTAGTTGGATTTTAACTATTAAAAGTGCTCACATGTCAACTGCTTTA
GTAAGACCATCTGTCCTTTTGTGAGCCAGCGTACGACGGACAACCTAGTTTTTCAAAAGAATTGATAATTGGTAAGACATCTAGGCTTAAGTATGAAATG
GCCCAGAATGGATTAAGTGAGACCTGATTCGTAGGACGGTCGACTTACGCTTAAAGATCGCCTCCTATTGGAGACACTTTTTTGCACTCATTTTGCGACG
CAAACATGGAAACCGTCAGACATAACCCCACTCCTCCACCTCGTTCCTGCTGCCGAATTACCCAGTACATGTACTAGTGTAGCGCCAACCCCTGTGCAAA
TTGCATAGTACCATTACCTTGCTAATATAAGTAAGAAACAAGTAAGAAACTTATAATTTCTTGAGGATAACTGTGCTGCTATTAATAACGGTGTCTTGCT
TTATGGCATACCTGTATAAAAATGTACTCGATTAGTAGAGCTGTACTTTCACATTTTTTAATCTTGACCTAATTAACTTTCTTGTTCTAGCTTTAAAAAC
TATTATATTAGTATATGAAAGGTCTACTGTAGTGGTTTTTATCACCAAAAAGTAAAAAAAAGGCGCTAAGATTTAATTTTTTTTGTTTATGATGATATTA
TCATGATTTCCATATAAAAGCACTACCAGCTCAACTCCCTAATATTACAAATTGATTGCAGGATAAGGCGTGGGCACTTAAACAAAAGTCGAATCGAATG
TTGCGTTTCCTCCTCGTTTTGTTTCCCTCACAAACCCTACTGTCTACATAAAAGTTGTTCATGTTACCATTGCTGCGCTTTTTCACAAAAGCCAAAAACG
CCTTGCCTGCCTTGTTACCGAGTTTGAGACGGACGGTGTTAAGCTGCTTAATCAACGGAAGGTTTGCGAACTTTGGGGTCTTGAATAAAGCCGAAAATTG
GCCAAGCTGGGAAGTCGTGATCGCCCTCTCTTCGCCCTTGCCACCCAGCTCAGTACTTTCTTTAAGATAGCGGTGGCCTTCGTTTACGCGTTCGTAAGGC
GATTGATTCACCAAGCTTGAAGTCTCGACGGTTTGATCAGCGCTTGCAATCGCGCTGTAACTTGCCAGCGCCAGGAGGAAAAAGTGAATTCCACGCATGA
TTGATTCTAAGTTGCACTTGTCCTGTTCGGGTCAAAATCGTGTGTGCGATGACTGTGGAATGTGTTCAAGGGCCACACTCTGCAGGTTTACTCCTCTATC
GCCTGATCGTCTGAGCCATATGGAGTAGGATGAGTTTAAATAGGGTATAGTTACAAGTTGCTTGTGATTGCATCAAGATATGGATATAATGTGTAAAGTC
ACCGTTCGACACAAACACACAAACTCCATTCAAACTCCACCAAGGATCAATCCTTTGAGTTTCCACATTTGAGAGAAATCGCCATAATTTAGAAAAGTAC
TCCGATTTCACTAAATAAAACACCGTCTCTGAGTTATTAAGCTCGTATCCAGACCTTGAAGCACCAAGTCCCGGAATATATGTAATTATTGTATACCTAC
TAGTCACTTCGTGAACAAGGCCTTCGCGGCATTACATTGACGTTGGCATGGACCGAGGCCTGCCTAGAATTTATTCAGTAACAGGTAATTCACTGTAAAG
TTAGTATTTTGAAGTGGCTGTTCGGTTGGTGTAGGAACTGAAGGCATCAGCTAGTAAACGGTCTCTAAATAAATCCCTGTTTGAGCGATACTAGGATTGA
ATATGCCGGAGGTTAATGGGTTACCGTGCCACCGAAAAGCGACCAGAAGTACTTAACAATGTGGTTTGGTTTTGACAGCCGGTGTCTAGTCAGCTGTAGC
CTAAAATAAGACAAGTACGACACAACCAGCCTTATTAGTTATGGACATTGAAGAGACTATATAGATGACATAAACGGTCATTTGATTTTGATCTACTTAG
AAACACGAACTGCACGTTACTGCGTTTCAAACGATGCTTTGACCAATCAACCAAGTGCATATTTTCTAAACTGCACGTTGCTGCGTTACAAACGGCACAA
ACAATACGTTGAGCCACAAATCGAGGCTCAATTAATGGACATCTCTATATTTTATCTCGCCTGGCAGCTCAATTTGCTCTATTTGAGCAGTCGACCGAGA
TAGTGGTTAGATGCTTTACAGTAAACGTGATTATGTATGACCACCATACATGATTATGAGCACCATAATCATGTAAAAACGTCGTTTGCTCGAGCTCGAG
TCGCTGCCAGCGAGTCACTGTGTGTCCATATCCTTCTGCTCCTGGCGGTACAGACGCGCCAATTCGTCTCTCAAGTGTCGTAGGTTACGCTGGGTCACCC
AACCTGGGTGTGGGCCAGTCGCTGGGAAAGCGCGGATTTGCTCTTCTCGAGGGTGTTACGGTCCACCAGGAGTAGGCGGATCTCATCACGCAGCATTTGC
GTTGTGATACGGAGCGTGTCGTCGCGCACTTTGCTGCATGATGAAGAGGGGGACAGACGAGGCTTTGTTTCTGGTCGGAGGAGTCCTACGCTCCTTGCCA
AAATTTGGCTTAAATGTCCTACTAGGACGGGTCATTTGGGCCAAATTTTGGCGAGGAGCGTGGCTGCTTGGGCGAGCGCGCACGGGGTGACTTGATATAC
TGTAGTCTATGTTCGTGCGTGGAGTTGCTTTTTGAATTCTGATAGGCGAGATTTATTGTCGTTGGGAGTTTGAAATCGACATGACAGAAAGTTAGTGAAT
GCTCTTTATAGACAGCGGAAAGGATTGCTATTTTTCTTACAAAAAAACAACAATTTTAGGTCGAATATCGTACTTAAATGGAATCAAACTATTAAAAGTG
CTCACATTATGGAGGGCTTGTGCTGACAGCTTTGCCTATAAATGACATGGACTTTGTTCTATGTTGGCAGTATAAATAGATGCACTCGGAGGAGCAAATG
CGAAACGGTATTGAGTGCATAATTTTGATAGCTCGAAACCCATTAACTTCTCAGGCTAATCCAGCTTGCTAAGAAAAATTATCCATGAGACAGCTTCAGT
TTGCGAATTAGCTACTTATATATGATGGCACACAAGCAGCCATGATATTAGCAGAGCCTCGTCTTTAGTTACTGTCTACTAGCCACCACGAAAAATATTT
TTTTTGCTTCCTACGAAGATACAGCACTAGCTACTGTCTTAGTACCATCATGCGGGTATCTACAGCACAACCTTTAGCGGTATTCGGTGGGATACAGCAG
ATGACTTTACTGACCACACCGGTACTACGCCTAATACTGTATAGCAAAAGGATAATGCTGGCAATATAAGTAGGACTTGATAATGCAATACGCACCCCAT
GTCGACGGCTTTGCGGAGGTATTGAGAAACTCAAGGGGCTATGGAAAACCCTTGAAACAAGGATCCAAGCCTGGGTGAATAGAAAACTCGAACCCAGCTT
TCAGAAGTTGGCTGACGAAGGCAAGAATGTCTCGGATGTCAAGGCGGAGTTTAGGAACAGGTTGATGGGAGCTGGTTTGTGAGGTACGCTATCAGCT