Description :
From Genome Similarity Track
Location :
Scaffold_306:8077- 9369
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_306-fgenesh-gene-0.4RAN binding protein 10, partial

Sequence
1292 bases(100 bases per row)
TCAGCACCCGCGCAAGAAACCTAAGAAACTAGAGGCTTGCACAATAACCCTCAATGCCGAAGCGGAATGGAGCCGACCCAGCATTCAGGATGGCCATGTC
GTTAAACTCGTGCAACGACACGGCCGCAGCGTACTCACCCTCAGGCACGATAACGGGCGCAACGCCCAGGAACGTACCGTTGAGCGTGAAGAAAACCTGG
TGAGTAGCCAGGTTCAGCCCACAGCCCACCGTAAAGGTCGCGGCGTCCGCATTgTCCTGCGTGTTATTGCCGCCCCACGATGGCCCGTAGGGCTTCCACT
CTCCCCCATATGGAGCCGTTCCGTCATTGAATACGAAGTCGCCGTCGTTACCGTGGTAACCGAAGGACACGCCCTTCCAGCCGACGTGTTCATCCGATCC
GTAGCCGTAGGCGCCGCGTGTAGCGGGGTCCGAGAGTGATACAATGCCAACACTTCCACAGCCCTTCATAGCTACTTCAAAGTAGCTGACCTGTTGgCCC
AGGGCgCGTGCACACGAGAGCACTGGCAGCGGCTTGGTGCCCcGCACCGAGTCGACAGTGCTGCGCGTCAAGATGCGCAGGAGCGAGTTGTTGAGAATTT
CAGATGTGGCGTCGTCACGCTTGGTCACTTGGCTGCGCGTGGCGACGTCATAACTGAAGTCGCTGCGACGCTGTTGCAGCATCTGCAGCGCCGGCTTGAA
GCCAATCGAATAGTAGGGACGCGCCATGAACGGCACGTGCCACTTGCGCGCGTACAATGCGAGCACCAAATGGGCCGAGTTCTGGATGACGTCACGGAAG
TCGGTGCACACAGCAGTGGCGGTCTGTAGGTCGGCAAGGTCGAGGAACTCGAAGCTCAGTTCAAGCGCATGCGCTTCGAGGTGGTCATTAAGCGAGCCGC
TAGCCGAGCGCGCGCGGCGCAGTTGACGCTTGCGGGCCTTTtGGCTCAGGCGTCCGCTGCCATTGGTCGAGAGCAGCGTGGCGATGTGAAGGCgAGGGCG
CGAGATGTCGCTCCAGCGGAGGTCGCGAGTGGGTGAGGCTGCAGAGGCGTGAGACCGCGCTGCCACGGCGGCGTAGCTCTCGTAAGCAAGGCAcTCCGGT
GGGATGTCGGAcGCGAGCTGCTTGGACTTCATGGTGGGCGACGCCGCTTCGTCGAGAACGTCCGAGAAGCTCGCCAAGCGGCCACGCGaGgACTTGGCGT
TTAACACGATAAAGGTTCGTAACTTGTGGGGgCGGGGCGAGAGGCTcgTGACAGTCGCGGTAGCCACCATGGTGGGCGAGCAGGTGGCGAGG