Description :
From Genome Similarity Track
Location :
Scaffold_32:80768- 85085
Transcript NameFunction/comments
Phyke_g1852hypothetical protein

Sequence
4317 bases(100 bases per row)
TGTGGCGAATTTGGTCACCGATCTCTTCGAGAGTATGTTTGACTCCAAGTGGGAAGTCCGTCATGGTTCTCTGCTTTCGTTGAGGCAAATTTTCCTGTCT
GCTCGCTTCACTGTGGCTGTAGAGGCTACTCGGGCAAGTACGGATGAAAGCAAGCAACGAatcttcatcgacaagtGGTTAGAGGAATGTCTAGTCAGGT
GTATCTGTGTGCTAGCGTTGGATCAATTCGTGGACTACTCGGCTGACGGGACGATTTCTCCTGTGCGGGAGGTGTGCGCACAAGTTTTTGGCATTCTGCT
TGGCAGTCTCTATAGTGAAGACATCCTTGTCGGGTATTTGCAAGTACTGCGGACATTATTCTGTGGGTCAACGTGGCATGCTTGTCACGGTGGGCTTTTG
GGGTTGAAATACCTCGTTCGAGCCCATACTAATCACGCGAAAGTATTGATTCCACTTATTTTCGACGATGTCATGGAAATATTTTCTCGACCCAatgcag
aggaagatgtGTTAATTCTGACGGCCGACATGTTCATGGATTTTACAGCATATTTTCAAAAAGTTGATAGTGCGAGGGTTAcgaaagctgctgttctGCT
GTGGAGATCCTTAAAGATTCACGAAAATGCCGGTTTAGTTACTGCAAGTGTGGTCCGGGCGTTGAGTGCTTGGTATAACCATCCTTTCGTTGCAGCAATA
CTACAGAACGATAACGGAGTCAGGTCGGTCATTTGGGAGAATTTGGCGTGCACAGTGCCGATGTTACATCACCACTCGCAATCTGTTCGAGCGTCAAGCG
CAATGTGCATCTCAGCAATCTTCTCGAGCGAATCTACATTATCGAACGTAAGTGCTGCTGAGTTTGCAAGAGTTTTCCTGCCTCATTTACTGCATCAGTT
ACTACTGGAGCAAGATGACTCGGCGCAGCAAAGCTTGATTGGCTCATGGAAAGAAGTGGTGAGCAATTTGTCAACAAACGACCTATTGATGTCCGTCATA
GCTGAACAATTGCCCGTATGGATGGAGCTCTTGTGGTCTGCAGCTAGGATTAATTGTCTCAATGTGGAGGTGAGCAACTCACCACTTAATATTGACCTCA
CCGATCGGGGAGTGCAGTCTTCACGTGTAGCATTTGCTGAGGCAATtgggtttgctgttgttcaTGTGCCTGTGCCAAGCACGTGTATGAACAAGATAGT
CAAGCTGATCCGTGATGGAGTGTCTGCTAGCTGCGGGGAACGACAGTGTGGCGCATTGCTAGCGTTGTCAAGGTGGGGTTTTTTTGAAAGGCAACTAAAA
CATAATAGCGCAGAAGACCAGGCGCGGCGACTCCAACACTTAAAAGATTCGTTGGGGCCATTGCTCATTTCAGTTGCGGGAAACCAGTGGCAGTCGCACC
ACCCTGGCGCAGTTTTTGAAGGGGGGCCAGTGTTTTATACGGAGCAACTTGGACCAATGAAACGCGTCGCGCAAATGGAAGCTCGGATTATCGACATCTT
TTCATCTGTGGGTATTGCGCTTCAACCGACCCAACGACCAGattcagcatcaacagcagacATTTCGCGCACAATTGCTGAGCACATCGCTCTTTTTCCT
TACGAAAAGTTACAAGGCCACCCGGAAGAATACGAAATGGCGCACTTCAAGAGGCAGGATCTTTTTATCGTAGATGAGTTGGTACAGCAAGGCTACGCTC
GCTTTTATCATCGGATACAAGGTCTTGGTAGCAGCGCGTTTTGTGTGGTGTTACCAATTCCGAAAAAGAGCGGCTTTCTCGTCAAAGCACTCATGAACTC
AatcaaggaggaggatgaagatgtgTTTCGTGGCATTTCGGCACAAGCAATAGCGACTTTTGTCGTTGACCAGGCCTCTTCTCAGAAAAAATGCGTTGCG
AAGATCATTTCGAACCTTTGCAACAGTGCCTCTGCGTTGGTGAGCGTATTGGGTGGACCCTTCGATGGCATATTGGGATGCAGCGATGTGGAGGATGGCC
ATTACGCTTCGGTTTCCCCTGATGTTTTCAAAAAGACAAAAATTCGAGctgatggtgctgaggcAGCACTGCATGCTATTTGCAAAACTGCGGCTAAGTC
TCTTTTTCACGCGTGTCCTGCTTTAGAAGATGCTGTTTCCAAGGCGTGGAGTCACCCAGATGTCGACAATCTTGTTATTCAACGATGCATGCACTTGGTT
ACGTTAGTTGTGCCTCACGTGGAGAGCGCCGCAATGGAAAATTGCTTATTGTGGCTCGACCAGCTCGCGCAGTTGACACAACAGTCAGTCAAAGGTAAGC
AAACGAAATGCATTGTGGCCCATGCTATCGCCACTGTTTGCAAACATACACGAGGGTCACACCGCGAAAGCGCGATGCTCGTTGTGTATAATTCCGTTTT
CGTGGCATTTTCAAGCTTTGGGGATGGAAGTGCTACTACAACAGAAGCACTGGAAGGGGCAGTGATGGTGCTTGATCGCGTAGTCCATACACTTGGAGCG
GAATTGACGCCATACGTGCCCAGCTTGGTTCACTATGCTATGAAAACCATGAGCTCGCAATTCAAGCATGTTCGTACTTTGGCGGCTGGGGCATTCGCGG
AGCTGGTCCCATTAATTCCTCTACAGATGGACCTCGCGCTCGATGAATCCTATCAGGTTCTTCCAGATTCGCTACAAACGATCATTAACCAGAACGCAGT
GTCACGTAGCTTCCTCGAAAGCTTCACGAAGGGAAAAGCTGTTCAACACGTAGACGTTAGCGCATGGCTTGCCCACGGCACCTCTCTACGAACGTATCAA
CAGCATGGTGTGGACTGGATATGTTTCATGGCTAAGAACAATCTCCACGGTATCCTTGCAGATGATATGGGCCTCGGTAAAACGCTACAAACACTCTcgt
ccattgctgcagcgctacAGTCGACGGAGAACAAACACAAGATGATGCCGTGTCTTGTTGTGTGTCCACCGATTATCGTTCACCATTGGATTATGGAGGC
TCAAAAATATCTCCCCGAGTTCTTCGATTACATCATTGACTACTCACTTCCAGCCAGTGATCGAAAGGCTCTCAGGTGTGATGGTGGCATCCCTCTGTCT
GATCATGGATCGACCTTGATTGTGACAACGTACTCGATTCTGCGCTCAGATATTGAACGCTTGAGTGCTATTGACTATTCTTTCgtcgtgctggatgaag
cacatTTGATTCGTAACCCGACCACAGCACTGTTCCGCGCTGTGGTGGAGCTCCACGCATCTCATCGTGTTGCCTTGAGCGGTACACCGTTGCAAAACAA
TGTCACCGACTTGTGGGCTCTCTTTGAGTTTCTGATGCCAGGATACTTGGGTGATTTCGCGCTGTTCCGTCGTGAGTTTGTCCTTCCCATCACAAAGTCA
AAGGAACGaaatgcaacagcaaaacagaAGGAACTGGCAGCAATCGCGATCACGCAGTTGCACCACAAGGTGCTGCCATTCATTTTACGACGAACGAAAG
ACCAAGTGTTAGACGAACTGCCGCCGAAGGTCATATCAAATGTGTTGCTACCATTGTCACCACTCCAAAAGCGGCTCTATTCACTAGCGTCGTCCACTGA
CAATGAGGCCAGCTACTCTGCGTCAGACACACGCTCCTTAGCAGTCCATGACACCAAGCAGATAACGAACGTGTTCACAAATCTCCGATTATTGCGCCAG
ATATGTGTCCACCCGGCACTTGTTGCAGACACTGCAGTGGCTCGTGCGTTAAATGCGAACGAGAAGCGGGCATTAGGTGACTGGAAGAGTTCAGGGAAAA
TGACTGGCTTGCGCGACTTGCTAGTCGAGTGCTGTGATATTGCCCCGGGCAATCATGAGAGTCGACAAggtcaagctgcagacactctCAGCTTAGATAA
CTGCAACCTCTCTCCCCATcggtgcttggtgtttgcTCATCTACAGAAGACGTTAGATCTGACTGAGCAAATGTTACGTGATGCGTTACCACGGGTGACG
TATCGGCGCCTTGATGGCCATACGCCTCATGCTAAACGTGCTGACATTGTGCAGCGCTTTAATGCAGATCCGTCGATCGATGTGCTGTTGTTGACGACGT
CGGTCGGTGGTCTGGGACTCACACTCACCGGCGCTGACACAGTAATTTTTGTTGAGCACTCTTGGAATCCCTTTGTCGACCTACAGGCGATGGATCGCGC
ACACCGAATTGGCCAGAAGCGAACCGTGCGCGTATTTCGGCTGATCATGGAGAAATCGCTCGAAGAGCACATTTTAAACCTGCAAGCATTCAAAGAGAAG
GTCGCAGCCACGGTTGT