Description :
From Genome Similarity Track
Location :
Scaffold_419:807336- 811206
Transcript NameFunction/comments
Aphin_H310_01120Hypothetical protein
Aphin_H310_01121conserved unknown protein
Aphin_H310_01122ATPase family AAA domain-containing protein 3A

Sequence
3870 bases(100 bases per row)
CACTTCGAGTTCTTCGTCGGCGAAGTAAACGGCCGCGTCGGGCGCTGAAAGCGTCAGCCCTTTGGGCTCAAATGGTATGGTGCCTGTGGCATGTGCAGCC
AACAGAATCGTCGAGATTTTCTCGGACACTGCGATTGTGACGTCGCCCGATGACAGGAGGTGGATCGAAATGGTGCAGTCGACATCGACACCCGCATCGT
TCTGGATCATGCGCGGCAACGCGAGAAGGAGCTTCTGAAGGGGCCTTCGAAACGACGCGATCGACGTTGACGACGGAAGCGACGCCCGCTTGGTCATGGT
CAGAACCTTCTCCGGCACCATGAAGATCATGTGGCTGTGGTCTTGAGTATTCTCGACGCTGCGGGGCAGTTCCCGGTCGCTGCGGCGGCGATTCAAGATG
CGCTCTTCTGCCGGGTCGGCAAAGGACGCAGCAGATTTTTGCCCTTTGAGCTTGGTGGCTGGTGGAGACGCGAACGAGGTCAGGGAAGTTGTGCCTCGAA
GGGATGTGGAGGAGGGCGAGGCGGACGTAAAGGTAGTGTCGACTGGGGGGGAGTTGAGGCGGGTTTGGTTCGGTGGGGTTGGAGAGACTGCCAAAGGCGC
CACCACCGCGGCAGGACTCGCCTGCACCTCGTCCTCTTCCAGTGGAAGCAACACCCGGGCATGGAAGATGTCGTGGCTTTGATGCAACACCTGGTCTTGC
GTAGGCATCGAGTCGTCGATTTCATCTTCGTCTAGCATCCGCTGCTCCAAGATCTGACGCGCAACTTCTGCTTGCAACTCTTTGCGCTCTTCAAAGATGG
GGCGGATGATCACGCGGTGCGCCAAGTGGGCTGCTTTCGATCCAAGGGCCATGGCAACTTTGTCCACGGGGCGCAGGGGACTTCGTGGTTTCGACGGCGA
CCGAACGATGTCGGACGGTGCCAAGTTTGGAACTTCGTCGAGGGGCACGTGGTGCCGCGTCTGCTTCACCGACAACACGGGCTCGTACAGCGTGATGGAT
GGCAGCTCCAGCTTGATGCATTTCTTCTTGGGTCGCTTCGGCTGGAGCATCGCCGCGAAACCGTTTCAGGACGTGAGGGTTTCAAAGTCATTCTACGACA
GGGTGGCTGTTGATGCTGCCTTGTGCGAAATGTCTGCTTTAGGTTGCTGCCCGGCGCCAAGCACGAACGGGATCCGAGTCATGCACGGGGTTGTGTTGGG
GTGATTTGACGATTGACGAAATCTTGGGATCATATTGTGTGTGCTGTGGAGCCTAGATCGTAGCTCTGTCGCGACAGTCGCAACGATCGTGCAGCTGACC
TGTGCCATCTATCCTTGTTGGCGATGTTGGCGATGCCCCTTGAAGGGCATCCAACCCATCCACGTCAACCAAGAGCACTTTCATTCAAAAATGCACGAGA
TTTCTCGCAAAGCTACAAAAATAATCTAGAGAACAGGGAGAGGGACTTGGTAGTGGTGCAGAAGCAACCATCACCTGAATCACGCCCCAGAGAGCGGGGG
AGAGCGGCGTAAGGCCGACCCTCCCGCTTAGTGCTGTCCTTGAAAGTTAAACATCGTACCGCTGCCCGTGCCAAACGTAAACTGTTGCGCCGCGGGGTCT
TCCGTCGGCAACAAGTCGTTCTCTTCTTCGTCTTCTCCGCCAAAGTAGGTTTCAATGATCGCGAGCGATTTTCGGTACACCTCTGCAAACCACGATGACA
TGTCAGCGCTACATCGTTGCCCACCAGATCAGCTCTCACCCAACGCTTCGTGGTACTGCAACTGCTGAATCTTGTTCACGCCGTCGTATTCTTCCACGAT
GAGTGCCATCTTGTTCTCATCCGAGAGCTGTTCCTCTTGTTCTTCAGAGCCCATGCGTAAAATGTTCTCCAGTGCATCCAAGCACACGCAAATAATCTTG
GAATCCGTCGATTCAAGCAGGGCCACAAGCGGGGGAATGCAGCCTGACATGAATTCGTTAGTGAAGTGCCTTGATGGGGATCACATATCCAACAACGAAC
CTTGTTGGACCATATAGTGGAGTTGCTCTCGCGTCCCCCCCGACGAAGCGTTCGAGATGGCCCACGCCGCTTCCTTGCGCACTTCGAACTCGCCCGTGGC
CAGCAATTGGATCAAAGGGGGCAAAATGTTGGCGTTGATAACAGCCTGGATTTGATCGGCGCTGCCAGCCGTGATGTTGCTCACCGTCCAGCACGCTTCC
TTCCGGATGCCCTTCTTCGGGCTCTGCAACAGCGGCAACAACCGGTTCAACGCGCCTTCGTTGATCACAAACTGGGTCTGGAGGTCGTCGCCAGTCACAA
TGTTGCCGATGGTGCGCAAGGCGGGCGTTTGCACCGACGAGTTTGTGTGCAAGAGCAGTTCGATCAGGCGCGGGACCACGCCTGCTTCAATCACGGCTTG
AATCTTTTCGTTGGGGCCGTCCGAAAGGTACGAGAGCGCCCAACACGCATCCGTCAGCACATCTTGGTCTTGCGAGAAGATCAACCGCGCCAATGTGGAC
AAAGCCGGGCGCACCAAGTCGAAGCGCGGTTGCGGCTTGCCACGGCAAAAGTTGCTCAAGGTCCAGGTCGCATTGCGCAACATGCTAGGACTTGCACGTT
CCGAGAGCTGATGCAACAAAGGAAGCACCGCACCAGCTTCAAGCACGAGGTCGCGGCACGCAGGGGAGTCACCCGAGATGTTACCCAAAGCCCACACCGC
TTGTTCACGGACTTCGTCGTTTGGAGACATGAGCAAATACACGAAAAGCGGGACAGCACCATTCTGAATCACGATGCGAGTGTGGTCCGACGTGCCCGAC
GCAATGTTCGTCAAAGCCCAAGCGGCTTCAAATTGAAGCTTGGGGAGGTTCTCCGCTTTCAAGAACGCTGTGAAGATTGGCACGACGTTGAGGTTAATCA
CTTCTTGGATGGGGGGGTTGTTTTCTAGGAAGTCTGGTAAGCCAATTGTTGTGAAGATCAGCACCACATACCAATCGAAAGAAGCTTGCGGAACTTGGTG
ACTGCCGACAGCTGAACATCGATGTCTTGCGAGTTCAATTCTTCCACCATTTCAGGCAGTTGGGATAGCTATAAAAGAGAGTAAACTTTAGAGAGCATGT
GGGGGTCACATACGTAAGCCTGGGCACTGGTGCTGGCGGATGCGCTTTCTGATGACGGGAACGGCGAGTCGCTGACCATGCCTTCAAAGTCGCCAGGGGC
AGAACCCCCAACCATGCGACGGCGCCGGTTCACTTGCTCATCCTTCTTCGTCTTACGGATGTTGAGCGTGAGTTCTTCACGGCGGCGACGATTCTCGTCG
GCATCAATACCCTTCTTGAAGTTCTTGTGGCGATCGTCGGGGCGTTGCATGGTGAGAGCGTGCTGTGGAAATGGCGTTGTGATGGAGTCCAGTCAGTTGT
CCTCATTAGCCGTGCCCCGGGGTACGCAAGAACACCCTTTATCGTTGAGTTTTACCCATCCAAAGATCTCGGCCTGGTTCAATGGAAACCTGTGGTCGTC
CATACAAATATCAAGTTCGGTTGTTTATCTGACGGATTCGGGTGGGTGCATTTGTGGGTTTGTCCCAAACCTATCCTGGCGGGAGACCATCACTCCGACA
TACACCTACATTCCAAATTCGGAGTTTCGCGAAAGTGAAAGCTTCGACCGTAAGTACAACGCGAAGGCGAGGACATCGCTTGGAGAGGTTGGTGGATTGC
GTCGGAATGGGCGCGGGCAACAGGGGAAGCAGTTCGAGTCGACAATGCAAGTTTGATGCCTAATGTCGTTAAGGTTTCTCAAGGGTGCCAGCTAGGCCGC
CAAATTACGACTTGCATGCAAATGAGCTCTATTATCAATCTATTTGTCTTAATCGGACACGAGTTTGTGC