Description :
From Genome Similarity Track
Location :
Scaffold_1:807146- 809896
Sequence
2750 bases(100 bases per row)
CGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGGGAGACCCACCGATGGGCCTGCCTCCGGATCGAGGTGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCA
GGGGTGGTGCGCAAGCGTAAGTCTCCGCACTCGACACCCACATTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAGGTAAA
TGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGAT
GGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGAGAGTGGTTGGTGATGCCCCAGGGGC
AGTCGAACGCACCGGCAACGTTCAATCGTCTTGTGAAGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGACATATTCGTCCATAG
TCGTGCTTAGCACGGAAAGTCAGACGTGGAAAACCACATTGACCACCTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGAC
AAGTGCGTCTTTGGCGCGGAAGAAATATCTTTCCTCGGGTGCTTTATTGGGAAGCGAGGCTTAAGGGCAGATCCTACCAAAGTCAAGGCCATCGTGGACT
GGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGAACAAGTACAGCGCGAATTACGCGGAGATGGCTCGGCCATT
ATCAGATCTCCTTAAGAAGAACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGGGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTT
GCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAGC
GCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATT
CAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCA
AGATGGCTTTCCTTCTTTGCCGAGTATAGCTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACG
AGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGG
GAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATATTCACTCGATGGCGGCCTGCTGTACTACAGCACC
GACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAATATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGCCACTTAG
GTCGGGAGACGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACG
GACAAAGTTCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCC
AAGGACAAGGCAGGAAACACGGGCATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTA
CAGCTTTGCTGTTTTGAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTC
CCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGAGGACCATCCACAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATC
CTCCGAAGCGTATGTGCTGAGGCGCCAAAACGCTGGGGCCAGATGCTCGCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACTCCTCGACAGGCTACA
CTCCGCTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGAAGAGATAGCCGAGCGGCTAGC
TGATGTCAGCCATGTTGCGGCTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAA
GACATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGAGATCAAGTTTTATTAAATGCAAAAAACCTACCTACTC
ATGCAGTGTCTGCGGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTAACCTTCC
GAAGAAGATGCGCACGCATCCGTCTTCTACGTTGGCTTACTCAAGCCGTA