Description :
From Genome Similarity Track
Location :
Scaffold_764:8066- 11971
Transcript NameFunction/comments
Phyta_totarag10598ser/thr kinase

Sequence
3905 bases(100 bases per row)
AAACACACCCGCAGCCACCAGAATGGCTTGAAGGAGTTGTGACGCGATTTCTTTCACAAGAATCATGCTGTTCTCGTCTTGTGCCAGCGCATACACGATC
GGTCGTAGGTTGTACTCCACGAGAAATTGAATTGGTGAGGTGTGCGACTCGAAGAGGCTCTTGAGCATTTTGAGCAAATTCTTGCGCACAATCGCCTTCG
GAATGAGTCGAAGCCGTTTTAAGATCTCTGTGACGAACATGCCACTGCGTCCAAGCGCCTGGTTAAGCCTTACTGAGCGGCTCATCATCTCCAACAGCGG
CTCCAGTAAGTTTTCCAATTCCGTGTCCAGCGCGTTGTGAAAACACACCATAATTTTCATCAGGTTCTCGGGGACGAGTAGAACATTCTCCATTTTCACC
GTGTCGTGCACAAGCCAAACGCTGATGGACTTAATGGCATCGATCTGCCAGTATTTatcttccagcaactccagaAAGAGTGTCACACTGTCATACGTCC
ACAGGTGAGCTCGTGCAGTTGGCGACGCATGGGCCAGATCGCATAGGATTGGGAGTGCAAATTGCTTGAGTGGACTGGAATTCCGAACTACCTTGATAAG
TGAAGGAATGACACCAGCCTGTGCCGCGTGAGTCTGCCGGTTACGATTAATCCGGCAGAGGTAGAACATGGACTGGAGCACAATGTTTTCGACCTCTTTC
CGCTTCGCATCTGAGATGGATGGACCTCCTGCCTCTTGTTCGTTCAGTAGACGGACAAGAGTCGGGATCGCACCAGCTCGATCCAGTTTCTCCAACGTTA
AGGGCTCCATGCTCAGATTTCGAATGCACTTCAGTACTTTCAGCATAGCCGAAACAAATTCATCTGAGTGGCGTATTAGAGGGAGTGCCCGCCTtccttc
ttgctgttgctcgcCTGAACTTAAAAGCGGCGCCCCCGGGTGAATCGCTTCCAGAAGCCCTTCCAGGACAGCACCATCACACATGTGTTCTTTCACCACA
GCGTCGCCTTGAGAAAACAGCACGAAAATATCACACGTCTTGTTAAGCTCCCTCATGGTCCACTCTGTCATGGATCCACCCTTAGTTGCTTCTGCGTTTC
TTTTCGAAGATTTCTTCGCACTGCCATCACCTTCTGGCCCACGTGTATCATTTGCCGATACTGACACAACAATCTCGGAAAAGACGACCACAAACTTCTT
TAATAGCCCCGCCTTGACAAAAAGTCGGCAAATATCGTTTTTCGGGATGGTCTGGATACTGAAAACGCTGAAGATTCCATCCAGAGCTATCCGAAGCAAA
TCCACATCGTTATCGAGATTGGATGGTTTATCTTCTAGCGTCAAGAAGTCCACCAACACAGGTAATCCACCACACGCGATAAACATTTGCAGTGTCAGCG
AACTTGTTTTGCAACACTGTCGCACAAACTTGGCTGCCTCCATACGCACAGCCTTGAAAAACTCGTTGTCCTCCAGCCTGTCCATGCGGAACCCTCTGCC
GCTTTCACCCGGTAAATAGTATGGGTTATGTTGCTTTGTGAGCTTAATAATCACCGGCACTAGGCCAACGAGTGCTAAATTTTCCTGGAACTTTTTGTTA
CCCTCGACAATCTACAGACATGCACAACCCCAGAGTTAGTGATACTGATAGAAACCACAAGAAATATAAAGACGTCGTACAATATTGATAACCCTGAGCA
CAGCGTGCAATAcgtccatcttcttcatttcCAAGGCTTCCATGATGTTGGGTACAACACCCGGTTGTGACATCAAATCTCGTCTCAGCGTCACATTCTG
ATCGAATAGCTCTTCCTGCACAATGACAAAAATCCTCGGTTAGTGAACTCCATCGTTCCATCagttctgcagcagatcccCGTCACAACTCACCAAGTTA
TTGCAAGCATCTAGGATGACTTGGTCGTCCATGCTTGGATCCAAtaacgacagcagctccaccactcGAGCAGTTGCCTTCTGATTCGTATCACGAGCAG
TGGAATAATCAAAGTCCAACTCGTCATCAAACAAATTTTCTTGCGCACTCCCACCAGAAGACGACCCCGCATTACTGTTGCGATTGCCACCAACGCGTAG
CACCAAATTCCCCACTTGACCCTCTGCGAAGTCAAAATCCCCATCCATAGCATCGTCCTCCTTGAAGGCACTGAGTGATTTCTTGGCTGGGACTACCGTA
GCAGGGATGGATTCCGTCTCCATAGCGCGCTGTTGCTTTGCAGCCGCTTGTAACAGTTGCTTCTCGTCGATATCGTCGAAAGTGAGGTCTTCTTCCGGGT
CTTCAACAAATTGCTGAAGCTTTGCTATACGGATTTGAGCAGGAATCAACGACGACCGATCCCAGGAGTTCATCGTAGGCTTATCGCTCTTGCTCTGGGT
CGTGCTGATACCACTGCTACCGTGGCTCACATCTAGTACAGTCGATCTCGCTGACAAAACCGCAGTTTCgggctcttcgtcgtcccATACATCATCGTCG
AACAATGCGTTAGCATCTTCTTTAGACAACTGAAACTTCGGCTTGGTCGGTGCAGTTTCCGCTGCTGGCTTGGGCTTGCTGTCTTTCCTGTCACCGTCAT
CCCTGAGTACGAACGGGGTGGGGTTCGAATCCACACCGAACTCATTGTCCCAATCCTCGACATCCTCGTCGGACTGTTCATTTGTGACACTGAGAGAACG
CGAAATTTTGCCAGTTGCTGTCGGTGGTAtgtctgcagcagacgagCTTTTCTCGTACAGTTTGATGGTATTTAGCACAGCGTCTCGATCATTGGAAGAG
GTGACGCTCTCTGCAACGAGCTGAGTACTTTGCTCCACTTTGTTCTTTGGAATTTGTGCGATCCACGGATGTGCAAGAAGTTCCTCTGCAGATGCTCGTA
GTCGAGGCTCTTTCATAAAGCACTTCATGATGAAATCGTGTAAGGCCTGTTGCAAGAATACAAACCATGCGCAAAAAATCAGCCACACACACGATACACG
TGAGCACAGTTAATCACAGAGTCTTTACCGGTGACATGCGCTGCGGGAGCGGTGGGTGGTCTTCTTGCACGATACGGAATAGCGCAGCCATGGGCGCTAA
GTCGAAATACGGAGGTTTGGTCGTCAACAGCTCGATGATTGTGCAACCCACGCTCCAAATATCTGAGGCAGAAGACCAGCCTGACATCTCAATCACCTCT
GGCGCCACTAGAATACAACATCCACCAAATGCACAAAACCATTAGCAACTCACAAAACAAACATAACCACGTACTGTAGCAGCACAGAACTTACTCCAAT
ACGGCGACCCCACAACGGAGTTCGCCTTCTGCGTCTCGTTCAGTTTGATAGCGACGCCGAAGTCCGCCAGCTTCACAAGTCCGTCCTTCGTCGTCAGGAT
GTTTGCCCCCTTGACATCTCGATGCAACACGCCTTGCTCGTGCAGATACGCCAGCCCTCTCAGCACCTGCGTGATGTACATGGCCACCAGCGTCTCGGAC
AACGACCCGAACTTCTTGATAAACTGCGCCAACGAGCCGTTCTCCATGTATTCCAGCACGATGTACAGATAGCCTTGCGTCTTGATGGTGTCGTGGTACT
TTACGATGTTCTCGTGCTTCAATTTGCGCAGTAAACTGATCTCCGTCTGTCATGTCGTACAAAACAGCATAATTCTTCTTAGCCCTTGACAAGGATACCT
CCCAAAAATGATAGTTTCTTTATCCTGTAACCTCAATagacagcagctcgtccttaTCGATGTCCCGCAGCGACACTTGTTTGATGGCCACAGAGCGTCC
ATTACGCAGGTCCAGTGCCCCGTAGACAATGCCGAAGCCCCCGCGCCCGATCTCCGCCCCTAATTGCTATCGCAGTCATTTAATAAATTAGAGAGACCTT
ATAAA