Description :
From Genome Similarity Track
Location :
Scaffold_154:8066- 10123
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_154-abinit-gene-0.64Glycoside hydrolase

Sequence
2057 bases(100 bases per row)
CTTCACCTGGTTTCCGAGTTTGTCCATGGCTGTACATGACATAACCCCATCATAACGACACATGCGTAAGCAAATGAGACCTAGCAACGATAAATACAAC
AGCGCAAACATGGCTCGTACCGCTCTTCTTCTTCTGCGCGATCACGCCCAGTACGATGAACACCACGAGCATGACGGCCAAGAAGACGCCGACGCCGACA
AACACGATCTTGGGCGCGCTCTTGCTGCTGGCCAGCGAGCTGCACGTGCTGATGTCCTTCACACTGCAGTCGCTGCCGGTGTAGCACGTCAGGCAGCTGC
ACGCCTTTTCGCCGTTCACCGTCAAGCACTGACCGTTTTCACCGCAGTCCGACGAGACCTTGCAGGCGTCACCACCGCTTGCGACCTCGTACGTGCCACA
CAGGTCTTCCTCTGATGTACCCACCTTGTCCGTCACCGAGACGTCACACTTGCCACCACTGTCGTCGCAGACAATGCCCTCACGACTCTTGGCGGTCCAC
GTGTCCGTGTCCGCAACCTTCAATGCCGCTACAGAGCAGCTGTCCACGATCCAACCGCTCGTCGTCGCTCTCGTGTTCGAAGCCTGCGTGGTTGTCGCCA
CAGTCGGCGCCCACGTGCAAATCGTGCTCGTGGTCCAGCTGGCCTTGTCGCTATACGGCGAGTACTTGGCGAACATGGCCTTCAGGTTGGTGTAATCCAC
GGACGACTTGGTACTCGGCTGCTTCAGTGGGTCCTGGGAACCGCCTGTAGTTATTCACATACATACAGCAACAGTCGGTGTAAGAAGCGGTTAGAACTAC
GGGCTGCAATAATACTAGCAGGACAAGTTAAAATCGTACCAGTGAACATGGGGAACTTGGCATCCGGCGCCAGCTTGGCTTCGCCATACGAGTACGCCAC
GCCGCCCGAGTACACTTCCGAGAACTGCTTCGTGTCGGCCGGTGTGCCGTAGTAGTACGGGATCATGCCCCAGTCTCGCGGCACCGCCGAGTCCTCTTTG
CAGCCGTACTCGCCGAACGCGACTGCGATCGGGATTCCCTGGGCAAAGTTGATTAGACGCTGGTAGGCCTCCGCAAAGGTCGACTTGGGGCACCATCGAT
ACTCGTTGATCAGGTAAATGTCGATACTTTTCTGCATCGAGCCGTCCTTCATCTTGTCACCACAGAGCAGACCCTGGACCTTGAGCACGTGGTAGTCGTC
GGCGTTGTCGATCTTGCCAGCGTAACTACTGTCGGCAGCGGCGTACGCGAGCGGCAGCACGCGCATCTTCTTGCCGTTCACGCGCATCCAGTTCTTCAGG
TCGGCGACGTACTGCTTCACGCACGCGGCGGCCGTCAGGTCGACCTGCATGATCTCGTTCGCGACGATCATGCCGAGCGTGTTGTCGTACGCCGCAAAGT
TTTTCGCGATCTACAAAAAAAAATCAATAAATAATATATGAATAAATCAGGTCCACGGTAATAGGCCGCCATAGTGAAGGTAGCTTCACAAAGATCGCGG
CGTACCTTCTTACCGTACTCGAGCAGCAGCGCCGGGTAGCACGTCTCGGTCTGGTCGACGGTCTTGGCGCCGGTCTTGGACGTCGTGACCTTGCCGTCCG
GCCCGAGTGCCTTGGTGATCGTCGAGTAGCGGTACTTGCCAAAGTACTCGTCGTTGTCGGGCGAGGCCGAGACGAGCACGTAGACGCCTAGCGCGGCCAT
GTCAGTCATGAAGTTCTTGTACGACTCGTCCGGGTTGATGTTGTACACGCGCAGCGTGTTGAACTCGAGACCCTTGAGGTTCTCCGCGATCACTTTCTTC
GAGTACGTGTCGTAGTACGTGTCGCTCACCGCGTACTCGTACGTCATCTACACACAAACACACACACGTACAGTAAGCGCCTCATATACACACCACACAC
ACATATACACACGACGCGCTATGCACGTACGCCCTTGAGGAAGAACCGCTCGCCCGACTTGGAGTTGTACATCTTGCTGCCGCGCACGAGGATCACGCCG
CTCGCGGCCGCGGCGTCCGTCGCTGGCGCCAGCAGTGCGCCCACGAGCGCCATCGCG