Description :
From Genome Similarity Track
Location :
contig_87:80655- 82381
Transcript NameFunction/comments
g12401.t1KUF84077.1 ABC transporter G family member 15 [Phytophthora nicotianae

Sequence
1726 bases(100 bases per row)
CCGAGCGTGCTCAGCTGGAACAACCTTAGCTACTTCGTGGCCTGCCCCAAGTCACCTGAGACTCCTACAGGCAAGAAGGTCATCCTGGACAACGTCCGCG
GCCGCTGCGCGCCTGGAGAACTCACGGCCATCATGGGCCCGTCCGGATCGGGCAAAACCACACTCGTGGACCTGCTGGCCGACCGCATCAGCTCCGGAGA
AGTGACGGGCGACATCGAACTCAATGGTGAGGCCCGCGTGACCAAGACGTTCCGCGCCGTGACGAGCTACGTGGCCCAGGAGGACTCGCTGCTCGGGTCC
TTCACGGTGCTCGAGACCATGCGCATGGCCGCCAAGCTCAGTCTGCCCACGAGCGTCTCGACGAGGCAGATCGAGGCCCGCGTGGACGACGTGGTGGAGG
CCATGGGGCTGGCCACGTGCCGCCACACACTCGTGGGCGACATCTTCCGCAAGGGCCTCTCGGGCGGCCAGAAGCGCCGTCTTAGCATCGCCATCGAGCT
GCTGTCGAACCCGAGCATCCTCATCCTGGATGAGCCCACGAGCGGCCTGGACTCGAGCGCCACGCACAACGTCATGAAGTTCATCGTCAAGCTCTGCGCC
GAGGGCAAAACCGTCGTGTGCACCATCCACCAGCCTTCGTCGCTGGTCTACGACATGTTCACCAACGTCGTGGTGCTGTCGGCCGGCCAGACCGTCTACT
GCGGCCCGCGCGGCCACATGATCCCGCACTTTGCGTCGTCCGGCTACGATTGTCCTAACTACATGAACCCGGCCGAGTACTTCATCAGCCTCGTGAACAC
GGACTTCGACGACCACGCGGACGTGCCCAAGCTCGTGCAGGCCTACGCCCAGAGCGAGACCCGCAAGGAGCTGAGCACGCGCATCGAGAGCGACCGCAAG
ACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGCCCTCGTCTCTGCGGCAGTTCAAGGTGCTCATGTACCGCAACACGCTCAACAACATCCGCAACC
CGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAACGAGCTGACGGAGGAGGACCT
GGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGCGCCGTGTTCGCTCGCGAGCGC
GCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGGTCATGTCGACGGCGCTGGTGG
TGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTCGTCGTGTCCGAGTCCATGATGCACGTGATCGGGTCTGCGGT
GCCGCACTACATCATCGGCATCGCGTTGGGTGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCTCGCGCCTCCATCCCGGACTAC
TGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCTTTCGTGTTCAAGCAGTTCGAGAACGAGACGTCGGACGCTGCGAAGGCCATTC
TGGTCAAGTACGGCATGGAGGACGTGGACGTCATGCAGGACATGCTGTATCTTGCAGCCTACATCGTGGGCTTCCAGATCATTTTCATGTTTATCCTATG
GAAGTTCCACACAGGCCGCCGGTGAG