Description :
From Genome Similarity Track
Location :
scaffold_12:806209- 808354
Sequence
2145 bases(100 bases per row)
GTCCAAGTACACGTCAACATGTCGGAGTTCGGAACTCCCGTGCAGCCATGGCATACGACACGAGATCGAGATTTAACCGGGTGCAGGATACCTGCTATTA
CATAAATCGCCGTTGCCAGCTGATCATTATTTTAGGACTCGTTCTTTGCTGCTAAACAGCAACAGGGGTGGGTGAGAGAGATTAAATCTTCCCACAGTGT
GCCAACCTTTTGCGCTCGCAAACGCAATGGCAAGAAGTCCTAGTACAGAACTTTATCCCTCGCAAGGATGCCAGTATCAACAAGGTGACTGGCTCAAAAA
TCTTTAGTGTAATTGATCTGGATTGATCTAGTAGATGGCTACAATCAAGTTTTAATGAATCCTCCATAGCGGTTGCTATGGGAGTGGTATCTCGTTATGC
ACTTAATCCGTCCATTGCAATCGTTTGCGTCGACGTTTCTCGATGACATCTTTGTCCATCCAAAGCCCTAAACAGGTCAATCGATTTACCAAGCTCATCC
TGAACACATGGAACAGGCATTGGCGCGTATGACAAAACATCATCGATTGACATATAGGTATTCGGCGCCAGAGAAGTACTTGTTTTGGGCTGTTTGTCGG
CGCCGACGGTGTCTGGGCAGACCCAGCGACGAACAAAGCGATCTCAGAATGGCCTGCGCCAActaaccagaaggacttgagAAAAAGGCTGGGTCTGGCC
AACTATTTCCATTGGTATACCAAGAATTGTGCCGACTTGGCACGCCTGCTATCGGACTTGTTGAAGAAAGATCAAGAGTGGTTATGGACAAAATGATGTG
CAGTCGCCTTTGAATAGATCAAGCATAGCTTGCAGGTAGCAGCAATTTTGGCGTTATCAGCTGACGATTTACCGTACAGTGTCGTGCGCGTAGCCTCCGA
CTTTGCGATCGGGTGTGCAGTGCTACAGCAAGCTGTACAGACAAGAATGTGTCATCTTGTATCAGTCAAGCAGCTGAAAACAGCTGAACGGAATAACCCC
GCTCACGACAAAAATCTGTTGGCAATGCAGTATGCTTTGGCAAACTTTTGATCTACCTCGTAGGGTCCAAGCCTTTCGCCGTTCACACCGACCACGCATC
GCTGCGTACAGCGACTCAAGCGCCGCAGTTGTCACAATGGATGACCCGTTGATATTCTTTCCAGAACACAACTTTACTGTGGTATAAAAGTCAGGAAAAC
TGAATGTTTTGGAGGATGCCTTATCTCGGCGTCCTGATTGCACATGATCAGTGATTTCCCAAGCTTCTTCCAGCGTGCTCGATATGACACGGCAAGCGTA
TCCAAACGACCCATATTGTGCTGTTTTCCATAAGTGGTGGACAACAATGGGTAATTCAGCTTTATCGACATAATAATATCCGCGAGATTGCGCTCGGACT
CATCCATACTCCCTCGAGGACGGATTACTGTTCTACCAAGTACATGAAAGAGATGTCTCGCCTATCGCGAGGCATCTCGGTCCGAAAAAGGCTTATGTAG
CGCTTGCACACCACTTTCGGTGGCCCAAAATGTATGCTTGGGTTTAGAAGTACCTTCGTACGTGTGACGTTTGTCAGCGTGTAAAGCTCTCTCCACACAG
TCAGGGTCCGTTGCAGACTAGCAGATTGCTGACGGTCCGTCACTTTGGACTTTTTCTCTGATCCTGATGCCGCTGGAAGTAATGATTtttggtctttgta
gacTGATGGTGCACCTCGCACCAACGGCTGATTTTGTTTATGGGGAACAGAGCGCTCGATTATTTATCGATCATGTCTTTCGGCATCGTGAATTACCAGA
GTCACTCGTATCCGATCGTAATACGCGCTTTACAGCGGGCTTTTAAATAAGATTATTTCATTTTCTAGGTACTCGCTAAGAGATGGCCACCAAGGACCAT
CCAGAGACCGATGGTTAGATTGAACGCGCGTATCGCGTTGTGGAAGacactttgtgcatcgtcGCCGACGAGATGGAGCTATCTGTCCCGATAGTCAAAT
TTGCCATCAACAACGCAGTTTATGCTTCAACAAGCTTTACGCCATTTTACATTAATAGCATTCGTCATCCGGCATTGCCTCTTTGTCTTATATGGACACG
CAAGATTCTGGGGAGGGAGGGGCTCGGCAAGCGTTTGCCTCCCAG