Description :
From Genome Similarity Track
Location :
Scaffold_74:80613- 89939
Transcript NameFunction/comments
Hyaar_Emoy2808099UDP-glucuronic acid decarboxylase 1
Hyaar_Emoy2808100hypothetical protein
Hyaar_Emoy2808101PREDICTED: BET1-like protein-like
Hyaar_Emoy2808102NAD-dependent epimerase/dehydratase
Hyaar_Emoy2808103hypothetical protein
Hyaar_Emoy2808104hypothetical protein
Hyaar_Emoy2808105p8MTCP1

Sequence
9326 bases(100 bases per row)
CTGGATGTGGATATTCGGGTGGCCCGCATCTTTAACACGTACGGCCCGGGCATGCACCCGTATGATGGACGCGTGGTGAGCAACTTTATCATGCAAGCTC
TGCAGGGCGAGGACATAACGGTCTACGGCTCGGGCGACCAAACGCGCTCGTTCTGCTTTGTGGATGACCTTGTGGAAGCTATCGTGCGTTTTATGGACTG
CACGACGTGTGTGGGGCCAATGAACTTGGGTAACCCGCATGAGATGACTATCCGCGAACTTGCTGCAGTCATCATCCGCCTGACAAATTCTAAAAGCCGT
TTGGTGTTTCGCGATCTGCCCAACAACGACCCCAAGCTGCGCAAACCTGATATCACTCTTGCCAAGTCCGTTCCGCTCCGTCTTGTTTTTAGTATGGATG
ATGTTAATGATGCTTACGTGTTGTTGTTTCTCTTGCTGTATTCTAGAACGCACTTGGATTGGAGCCCTAGCGTGTGCATTGAAGATGGGCTTATGCGGAC
GATTGCATACTTTCGGGACTTGGATTTATCCAAGTACAAGCAACCAACGAATAACACAGCGCACCGAAAGAGCGAGATCGCGAATCGGGCTAAACAAGGT
CGTCAGTAGCGTCGCGTATCGCACACTTCGTATGTTTCGGGAATTTGCGCTCGCCACACGAGCCAAGTATGTACACATGCCGCATAGCATTTTATGTGAT
CTATTTCATGTATGAAAGAAATGATTAACTACACACGTCGTTTGTACTATTCTAACTACAATCGATAGAAAATTATGCACGTCTTCCTTGCTGCGAAGCC
GGCCACGCCAACTGAATACATTCTGATCTTCTCGGCAATGAAATATTTGGTCTTCATCAGTGTTGCCACCCACCGCATCCCCAACTATAGCCGCGAAGAT
AAGAATAGCTGATGTAAATCATGGTAACTCCTCCATTTAGTCAAACTCATGGAACCTGACATCGCCACCGTCATGTTAGTTGTCTAAGCTGCAACAGAAG
AGAACATATCTGAGCAGAAACGAGCAGACCAACCAACATCCACAAACATAATTTACAACACAGGAGCACCTGTCCTGAACATTATACGCTGTCAATCCGC
CTCCACCTCACTGTTGTTCAATGTCCGGCGGATGCAAGTACAGACTTTGTCGCTGCTCACGACATCCCGTTGCACAGATAACCGGGTACTTTCCCTGTTT
GCCAACCTCGTGTACTTTGACATCCGATTTCGCGAATTCATGCCGCTGCTCAGCCGATAAGTCATCACGAGATATGACCGAAAAGTCCGTTTGAGAGCGC
GAGACTGATACCGTTCACACGGTCGTATCCTTCCGATCGTGCGATTTCGATACGTTCGCGCTTTTTCTTCAGCAGAGTACACGACCATCGAGAGCCCCAA
GCGATTAGTGTGTCGCAGGCTACCGTACCTTCTCGCATCACCATGTCCACGGTCAAACGACGTCTCAACCGTCCGTCCACGCTGCTAGAGTCGCACATGT
TGACCAACATGGCGTGATTACGCGTGATGACTGCAGCAAAGATTACGCAGCTGTTCTTGTGCATCCAAATCTTGGCACTTTCTGAATGTTCACGAAGAAT
GCTGTTGTCCAAGTTAAAGAGTTCTTTTACATTTTCTTGCCTTGCTTCTCTCGCCTGCTGCCAAAGAACGCGTCGAGATTCATGCCACTTACCAGATGTA
CCGTACTCCAGTCAGCAGCTGTGAAAATGGCTACAAAGAACACCATTTGAGAAGTGCGACCGGTTGCAGCTGTGTCAAGTGCGTGTTCTTCATCTTAGTG
CGCTTCTTCTTCATGCTGAAGAAGAGCTAAACTCAAAACCGTCGCCCCGACCAACTCGATAGTTGGTGTGCACTGCAAGCTCGAAGCAGCAGCTTTTTGA
TCTTTTTATCATAAGTGAATCTTGTTGTACCTTGTTACTACTTACCTGTGTTCAAACTCGCGAGAAGCGTGACGGGCTCGAAGGCTGTTCGCACAAACGC
ACATCGAAAACTACTTGCAACACATAACACCATTTCTTTGGCTGAGAAAACCAATCCATGACGTCGTTACACCTGACTAATGGGACCGAATGGCAAAGTA
CAGCAGCACAAACACCACGACCACAAACAGGACCAGGTAGAGCATGTGTTTGCTTCCACCCTGCTCCATCATGACGCCTAGCCGCTTCATCGTGCCGCCC
AGCAACCCTTCCGTGCTGTCAAATTCCTTTCCCTATAGGACAAGTCGTTGTTAGCAGCCACTACAACTAGCAACACTTCTGCTATCATACGATAGACAAT
TCTCACCATGCCGTCAAGAAAGTGGTTCTGGTCCAACACTTCTGCGTGGATACTACCCGATAGCTGCCGAATAAAAAATTAGTATCGGAAAAGTCTATAT
CAACAATATACAAAGCAACACATAAGCGCCACACAAGTGGCGACATTCTTCCAGACTTGCTTCCACCCTGAGATAAAAATAAATAACACCGACCTGCTTC
AGCTGTGTGATCTGCAGCGACAAGTGGCTGATCTGTTCATCGTTCTGATCTTCCAACAGCCGCTTCGCTTGCTCGCAATTGTCAACAGTCCGTCCACTCT
ACAACAGGAAGACATACATACATACATACAGACAAACAAACGGGTCCAAGCAAAAACACGGTGGCAAGTTAGTTCATGCTCCATCTGTTGCCCGCAATGT
GACTAGAAAGCATTCATATGCTGCTCAACAATACCTGAGGCCTTGAAGACGCTCCAGAGAAGAGCGACTCTCGCGCAGTGGCTCGTCCGTTCGCCATTCG
CTTGTACATGAACTTCCACTTGTCTCCCTGGTGACGTCTTCACTTCATCAAGAGAGATATAACAGTGACTGATTGGTCAATTTCAGACTGCAAAAACAGC
CAATTGAAGTGAGGCATTCCTTTTATTCTCGATGTGGTGCACACATCTACATCTTCAAAAATGATATAGGTGAAGGCGTCGCTTGAAAACAGTATTACCG
CATACTCTAGTTCCGTTCGTTCATTCTGTCAAACAAATACGTCTACATGCTTTTTCAGCACTTTCAAGGCATCGTCGAGTCGTCTGAGCGCTTGGTAATT
ACTGTCTTGCGCTCCAAGTACCTTCCATAGACAATGCCAGAGTCGTTGAAGCCGCCAAAGGCTGTATCGGCGTCTAATTGTGCTGTAGCAATTCACATAC
GCGACACTCGCACCGAAATTATTTGAGACCTTGATGACATTGTTAATATTCATGATCACGACACCAACGCTAAGGCTGTAGATATAGTGGTTGGCACGCT
TAGTGCATTACTAATACATCAACAATGACTACGGTTTGTTGATCCAATCTGCTGCTCACCGAAGCTATTCAGTAGACCTGCTGGACGGTCTACTTTGCTA
AGATAGCCGCTTCAGATGTTCGTACGAGAATATGACGTTCGTTCATGACTGCAATCCAGGATATATCGGGATCACACTACTTCACTTCCACGACATAAGC
TGGTCTTCATAGGCCGTATTCGCTTGAGTGATTGTTTCATTTCATACTTGCCATTTGTTGAGTCAAATACACGCCCTCTTGACCAGCGCCTTGATTGAAT
ACTCCTATAACCATATTAAACCTGGATTCCACGCCTTTGCCTCCTGCAAATTGATGCAAATGACGAGCAATGAATTGTTGCGTCGTCTGGACGATGGTGG
TGCCCGTTTTCTGCGTAAGCTGTGACCGATACGGCTTGCAGCCACCTTAGGGCGGAAATGGATGGTGAAGCTTGGCCTCGAACGTTGCATCGGTACCATC
CCGTGTAAACATGCCTTAAGCATATGCAGTAGGTAAAATCAGCATAGTTGTATCCCGCAGGTCACTGATACAAGCAGAACACGGCGGAAGTGACAGGATG
AAATCTGTACGCATCAACTCATCGTAGAACTCTCCTTCAGATTGTATAAGCACGATTCTCGCTGCACATGATTTTCCTTACTAAGCAAAGTTCGCAACTC
CACTGCCAGCGTCTCAGATACATTATTATACATGCTAGTCTTGCTGAATGTGCAGATCCAATTTTAGATTTTGTTCGCTTGGTTTTCTTTTCTTACTTTT
TCAGCTGGTCCAGTAAATATTAGGCACTCTTTTTATCGATTACATTTGCCGGAAAAGATAATTGTATGAATCAGAGACCGAAACTTCTCTATTAGCATTT
ATTCCAGAAATGCTCACCCACAGACCGACTACATGGACCGATGCATTGTTTGTGTTCGGCACTAAGAACAACTTGCTGCAAGATGGTGCGGTGACATTGT
CTTTTTCATACTTGTGGATCTTCGCTTTTTTATAAGTGTACATGTGCAGGATACAACCCGAAGCTGCATGTGTCAGCGGTGTCACTTGGCTCGTCAGTAG
TAATTACGCACCACCGATACACCGATACCACTCGAGGATCCGAGCAAGGCGTGATGGACCAACCCATTGAATCGTTGACTTTGTATGGTGACGAACCAAA
CAGTGTGAGAGCTGTGACCTGCTTAGGAGCAACTCCTTTTTTGGTGTATTTTTTTTCATAGTGGCCCTATTTGTAGAATAAGGCGCGCTATCGGTTAGTA
GCTTGGTCTCAGGGAACGATTATAAAGAGCCTGCTTGCGATTTCTATGACGACTCGACTGGATATTTGGGAAGTCACAGTATCAAGGTATTGTTTGGCGT
ATCGGCGAGGTCACATTCTCGCTCTTATGTTCGAATGCGCTGTGTTGATCTCTGTCGTAGTGGAATCTGTGCGAATTTGAAGGGTTCACTGGACATCAAT
CATTTGCAAGGAATATCGTGGAATCCCTGCTACGAAGTTTTGCTCGTATGTTAAACGAAAAGTGTGCATGTGGATCTCTTCTGCAGTGTCGTAACGAGAC
AACAATGTTTGTTTTCGCATGTAGACCTACTCTAAGACCGGTACATCAGTAGTCAACGCTTCCGGACCACTCTTATCGTCGCGTCAGCTTTATGCAGATA
TTGAAACATATCAACCATGGAGCGCGCGTTCGTGGAGTCCTTGCGGGTTGCACGTGTCGCTGTACGTATTGGGTTCATCGTACCTCGATTGATTGTTCCG
TGTTCACCCGTACTTGATATGATGAAACAGAGCGCGAAACCGCGCCCTCCATTGTCTCGGCTGGAAAGACGTCGATTGCTTACTCTGTGAACATCCGGAT
CATGACCAAATTGATGTGGGCACATCGAGAAGCATCGACGGGTTTCAGATACCACTAAAACCAAAATTTAATGCATTTTTAGCTGAAATAATACCAATAT
CAACTAATCTTTGTTTCCAAATTCTATTATTTGTTAACATTTCTTCAATTTCATCTAAACGTGTATTAAATTGTTCACAAAAAATGTAAATATCATTTAA
TAAACCTTTAGGTAAATCTTGATTAACTCCTCCAGGCCGAAAATAGGCTGCATGCATACGTGCACCTGAAACTCTTTCATAAAATTCCATCAATTTTTTT
TGAAGTCGAGAAAGCCTGCGCCGGTCAAATCGCAGCTGTAGCACGTGTCTCTCCAACCGTTTGCATCTTCACGACGGACGCAAAATTAATTCTGGAAGAT
GCTACGCGTGAGTACCCAACATTTGCATGATAACGTCTGATTACGGAGCTCATCCCAACTGGACAGAATGTGCACCAAGCCTGTTGCTGTTCCCCGATAG
CACCCATCGTGTAAAAATTCGAGAAACGATGGATACTTCCGTCCGCGGTATCATCGATTTGACGTCCAACGCATCATGTCAGGCTTCACAAGTACCACGA
ACTCTCTGCAAATTCTTAACCGCGCTGAGGTACAAAGTCAGTCCGGCCACATGCCCGGAAGTCGTTTGACTGATTAGACTCTATGATGTTAACAATTGCA
GGGTAAAGCGCCTTACCAAACGTCAGCATCGCATGCGATGCCACGCTCTCAAATGTGGACTCTTGGATACACACCGGGGAGATGGTTTGTTATGTCGATC
CTCGATCTACCCAATTTGACTTCTCCCGACGTCTTCGTTGTTCAGGTGTGTCGTGTGTAATACTACCATGAGTTGTAATGCAGATCGTATACACCGATTT
AACACTTTGACCACCCAGCAGGAGAGGGTAGCCATCGTTGGAAGCACTATGTCTTCGTGTTTGCTTTTTGCGCACCTAAATAATTCCGATCCTTTGAAGT
GGACGCCGTCGCTGTATGGGGAACTCGTAAGTACCGCTGTTGCTACATCCACGGCGATGTCATGATGACTTGTATGCCTACCTTGTTGCTCGCATACTAT
GTAGGATCTGCCAACTGCTCACGTGTGCAGAGGAATCCGCTTTACCGAGAACTCCTTGTATGTGGACGTCGCTACGACGGAGAAACGCAAACGCATCTCA
TTTTTCCAAGCTGCTGCGAGCCTGGAACCGCAGCCGGTCTATCTGTCGAAGTTCAGAGTGCCACAATATGCCCTATCCAAAGTTGCCCTCGGACCGACTA
GCAAATTGCTGAATGTGACTGCATTTGCTGGTAATGACACTCCGAGTAGCTTTGGTGATGACAACTGCGATACCAGTACGCACACGGACCTGCCGGAGCT
GATCGTGGCGAAAATGACGGCTATGCAAACGTAACGAATTCCCGTTTCGACCGCGTCGACAAAAAGCTGCTGCAATTAACAGCTCGTGTTGAGCAGCTGG
AGAAAAACGGCGGAGAAAGTGTGAAGTAATTGCCAGTGCTTCTTGGGTATTCTGAAAATGTTGTCGAGAGATTTTGACCGACTTAGAAAAGCAAATTTGC
CGTGATCTTCTAACCTGACGCCTTCTGTATCTTCAATCTGACGCCTTGATTGATATGCTGCAGTAAGGGAATACTGGCGAGTCACAGGCCTTTGCTTTTG
AGCTACGTCTGTTGTCCCGCCGAGCTACAATGCGGGTGACAAAAATATGTGATCGTAATAAGCTTGTACGGATTATTATTGAAGGACAGCGAGTATTGTC
TTAGCCTTTAGGAACTTGTGTAAAGCCCTCCGAGAGCGGGACGCGTAAAACATCTCCAACCTGTGTCCAACTTTATTTCCAACTACACAAATACACATAA
TCAGTTATTTTTGAGTCGTGATTTGCTTTCGATTTGTAGATGACAGATGAGAGCCGTACATAACACCGTATCCTGCGCCAAGTAAAGCTCCAAGTACGCA
ATTAATATTCGACGGCAACCACGATCCTGCTCGCGTCCCCACTTATTTCTATCGTAACAGAACTTCACTCGAGTATTCTGTGACCTTGGTCTTTGTGACC
GTCTCGCTCCTTGTAGGGGTAATTTCATCTGGCGACCCTACGTGCAGACTAGCGCCATTCATCTCTTCATCGGGAACTGCACCACCCCATATCCACTCAT
AGAGCCTGGCGGCGGTGACACGTCCAATGTCAGGCTCGTCAAGTTCTGTTACGATAGAAATAAGTGGGGACGCGAGCATGATCGTGGTTGCCGTCTATAT
TAATTGCGTACTTGGAGCTTTATTTGGCGCAGATACGGTGTTATGAACGGCTCTCATCTGTCATCTATCAAATCGAAACAAATCTCGACTTCAAACTAAC
TGATTATGTGTATTTGTGTATTGGAGATAGATTTGGACACAGGTAGTCTATCAATTGGAAATGTGTAACGCGTCCCTCCATAGCTGCCTTGTGTTCTCTC
TTACAATGCTGCACACGTATGGCTACTTTTTGCTATATTAAGGTTATATTGNNNNNNNNNNAAGTTCTGTTACGATAGAAATAAGTGGGGACGCGAGCAG
GATCGTGGTTGCCGTCGAATATTAATTGCGTACTTGGAGCTTTACTTGGCGCAGGATACGGTGTTATGTACGGCTCTCATCTGTCATCTATCAAATCGAA
ACAAATCACGACTCAAAAATAACTGATTATGTGTATTTGTGTAGTTGGAGATAGAGTTGGACACAGGTAGTCTATCAGTTGGAGATGTGTAACGCGTCCC
TCCGAGAGCTGCCTTGTGCTCTCTCTTAGCAAAAGCTGCACAACGTATGGCTTACTTTTGCTATATTAAGGTTATATTGCAGTCCTGCAATCCAAGATAA
TGGTATCAGAAACACAAAAATGAATAGGTCCAATTTATAGATGACGCGATCAAAAAGACAGTTTTGCAGCGCGTGCAAACTCATTGGTCAGCCTTTTTCC
TCCTTCCGCTTACAACGTTGGAGCTCAAACGTCCAATCCCCGTAATTCTCGATAATTCTTTGTGTACATGTGATGTGTCTCAAACGGCAAGTTCTACACT
CCCGTCGTCAGTATCCAATTCGACACCAAGAGCTCAAGAGTTTTCAGACAACATGGGACGTTCCCGTTCTTCACGTCCTGCCGCCCGCCCTGCCCCCCGC
CGCGCTCCTGCACCTGCCCAGGCTCGTCGATCGGCACCTGCTCCGGCACACAAGCAAGCAGCTCCTGCCCCTGCACATCCAAGCAGCAGCGGTGGCGGTA
TGATGAGCGGCCTAATGAGCACGGTGGCTCAAGGTATGGCCTTCGGAACAGGCAGCGCTGTCGCTCACCGTGCTGTGAGCGCCGTTGCTGGCTCGTTCTC
TGGTGGCGCGGATACCCCGCAGCAGCAGCCGGAAGGTGCCTCGACGTCGCTTGACCACCAGACCGCGCAGCCGCCGGCGCAGAACCAGTGTGGCGCTGAC
CAGAAGGCTTTCTTGGAGTGCCTGAACTCGAGCAGCAACGACATTGCTTCGTGCCAGATGTACCTCGACCAGTTTAAGACCTGCCAGATGCAGCAGCCAA
GCACCTTCATGTAGATCCGCTTTCTCTTGACGTCGACGCAGGCGTTCAAGCGTCAGCAAAGGCAATCGGCGAAAGCGACGACACCGACAAGGTCGTGGTA
TAGCTACTGGACGCTGGTGATGGAAAGGCGAGTGTAGCAGAGAACTTGCGGTGGAGCAGCCACTAGACACTTGAGTGAAGTGCGTGTGAGGGAAAATGGG
CTTCAGTTTTCATTTTGTTATTCTCTGCAGTGCCGGACCTCTCGTTTACTATGGGGTTGACTGCCTTATTGCGTTTTTACAGATTGCGATGGGCTGACAG
CGTTCTGTGAATGTCTCTGCACATTAATTGTCAAGAGGGTGACTTAGCGAATACGTCAAGCAGTCGATGTAGACCCATCGTAGCCATGTGCGAACGCAAT
AGGCACGATAGATTCAGACGAGCACGGAGCGACGAAGCTTCGTTTCGCTCTCGACTTTCGACAGCTGAAGAGCTAATTTGGACAACTGACTCTCTTTTAT
CGCAATAGAAACTCGATCTGAATAGG