Description :
From Genome Similarity Track
Location :
Scaffold_74:80613- 84238
Transcript NameFunction/comments
Hyaar_Emoy2808099UDP-glucuronic acid decarboxylase 1
Hyaar_Emoy2808100hypothetical protein
Hyaar_Emoy2808101PREDICTED: BET1-like protein-like

Sequence
3625 bases(100 bases per row)
CTGGATGTGGATATTCGGGTGGCCCGCATCTTTAACACGTACGGCCCGGGCATGCACCCGTATGATGGACGCGTGGTGAGCAACTTTATCATGCAAGCTC
TGCAGGGCGAGGACATAACGGTCTACGGCTCGGGCGACCAAACGCGCTCGTTCTGCTTTGTGGATGACCTTGTGGAAGCTATCGTGCGTTTTATGGACTG
CACGACGTGTGTGGGGCCAATGAACTTGGGTAACCCGCATGAGATGACTATCCGCGAACTTGCTGCAGTCATCATCCGCCTGACAAATTCTAAAAGCCGT
TTGGTGTTTCGCGATCTGCCCAACAACGACCCCAAGCTGCGCAAACCTGATATCACTCTTGCCAAGTCCGTTCCGCTCCGTCTTGTTTTTAGTATGGATG
ATGTTAATGATGCTTACGTGTTGTTGTTTCTCTTGCTGTATTCTAGAACGCACTTGGATTGGAGCCCTAGCGTGTGCATTGAAGATGGGCTTATGCGGAC
GATTGCATACTTTCGGGACTTGGATTTATCCAAGTACAAGCAACCAACGAATAACACAGCGCACCGAAAGAGCGAGATCGCGAATCGGGCTAAACAAGGT
CGTCAGTAGCGTCGCGTATCGCACACTTCGTATGTTTCGGGAATTTGCGCTCGCCACACGAGCCAAGTATGTACACATGCCGCATAGCATTTTATGTGAT
CTATTTCATGTATGAAAGAAATGATTAACTACACACGTCGTTTGTACTATTCTAACTACAATCGATAGAAAATTATGCACGTCTTCCTTGCTGCGAAGCC
GGCCACGCCAACTGAATACATTCTGATCTTCTCGGCAATGAAATATTTGGTCTTCATCAGTGTTGCCACCCACCGCATCCCCAACTATAGCCGCGAAGAT
AAGAATAGCTGATGTAAATCATGGTAACTCCTCCATTTAGTCAAACTCATGGAACCTGACATCGCCACCGTCATGTTAGTTGTCTAAGCTGCAACAGAAG
AGAACATATCTGAGCAGAAACGAGCAGACCAACCAACATCCACAAACATAATTTACAACACAGGAGCACCTGTCCTGAACATTATACGCTGTCAATCCGC
CTCCACCTCACTGTTGTTCAATGTCCGGCGGATGCAAGTACAGACTTTGTCGCTGCTCACGACATCCCGTTGCACAGATAACCGGGTACTTTCCCTGTTT
GCCAACCTCGTGTACTTTGACATCCGATTTCGCGAATTCATGCCGCTGCTCAGCCGATAAGTCATCACGAGATATGACCGAAAAGTCCGTTTGAGAGCGC
GAGACTGATACCGTTCACACGGTCGTATCCTTCCGATCGTGCGATTTCGATACGTTCGCGCTTTTTCTTCAGCAGAGTACACGACCATCGAGAGCCCCAA
GCGATTAGTGTGTCGCAGGCTACCGTACCTTCTCGCATCACCATGTCCACGGTCAAACGACGTCTCAACCGTCCGTCCACGCTGCTAGAGTCGCACATGT
TGACCAACATGGCGTGATTACGCGTGATGACTGCAGCAAAGATTACGCAGCTGTTCTTGTGCATCCAAATCTTGGCACTTTCTGAATGTTCACGAAGAAT
GCTGTTGTCCAAGTTAAAGAGTTCTTTTACATTTTCTTGCCTTGCTTCTCTCGCCTGCTGCCAAAGAACGCGTCGAGATTCATGCCACTTACCAGATGTA
CCGTACTCCAGTCAGCAGCTGTGAAAATGGCTACAAAGAACACCATTTGAGAAGTGCGACCGGTTGCAGCTGTGTCAAGTGCGTGTTCTTCATCTTAGTG
CGCTTCTTCTTCATGCTGAAGAAGAGCTAAACTCAAAACCGTCGCCCCGACCAACTCGATAGTTGGTGTGCACTGCAAGCTCGAAGCAGCAGCTTTTTGA
TCTTTTTATCATAAGTGAATCTTGTTGTACCTTGTTACTACTTACCTGTGTTCAAACTCGCGAGAAGCGTGACGGGCTCGAAGGCTGTTCGCACAAACGC
ACATCGAAAACTACTTGCAACACATAACACCATTTCTTTGGCTGAGAAAACCAATCCATGACGTCGTTACACCTGACTAATGGGACCGAATGGCAAAGTA
CAGCAGCACAAACACCACGACCACAAACAGGACCAGGTAGAGCATGTGTTTGCTTCCACCCTGCTCCATCATGACGCCTAGCCGCTTCATCGTGCCGCCC
AGCAACCCTTCCGTGCTGTCAAATTCCTTTCCCTATAGGACAAGTCGTTGTTAGCAGCCACTACAACTAGCAACACTTCTGCTATCATACGATAGACAAT
TCTCACCATGCCGTCAAGAAAGTGGTTCTGGTCCAACACTTCTGCGTGGATACTACCCGATAGCTGCCGAATAAAAAATTAGTATCGGAAAAGTCTATAT
CAACAATATACAAAGCAACACATAAGCGCCACACAAGTGGCGACATTCTTCCAGACTTGCTTCCACCCTGAGATAAAAATAAATAACACCGACCTGCTTC
AGCTGTGTGATCTGCAGCGACAAGTGGCTGATCTGTTCATCGTTCTGATCTTCCAACAGCCGCTTCGCTTGCTCGCAATTGTCAACAGTCCGTCCACTCT
ACAACAGGAAGACATACATACATACATACAGACAAACAAACGGGTCCAAGCAAAAACACGGTGGCAAGTTAGTTCATGCTCCATCTGTTGCCCGCAATGT
GACTAGAAAGCATTCATATGCTGCTCAACAATACCTGAGGCCTTGAAGACGCTCCAGAGAAGAGCGACTCTCGCGCAGTGGCTCGTCCGTTCGCCATTCG
CTTGTACATGAACTTCCACTTGTCTCCCTGGTGACGTCTTCACTTCATCAAGAGAGATATAACAGTGACTGATTGGTCAATTTCAGACTGCAAAAACAGC
CAATTGAAGTGAGGCATTCCTTTTATTCTCGATGTGGTGCACACATCTACATCTTCAAAAATGATATAGGTGAAGGCGTCGCTTGAAAACAGTATTACCG
CATACTCTAGTTCCGTTCGTTCATTCTGTCAAACAAATACGTCTACATGCTTTTTCAGCACTTTCAAGGCATCGTCGAGTCGTCTGAGCGCTTGGTAATT
ACTGTCTTGCGCTCCAAGTACCTTCCATAGACAATGCCAGAGTCGTTGAAGCCGCCAAAGGCTGTATCGGCGTCTAATTGTGCTGTAGCAATTCACATAC
GCGACACTCGCACCGAAATTATTTGAGACCTTGATGACATTGTTAATATTCATGATCACGACACCAACGCTAAGGCTGTAGATATAGTGGTTGGCACGCT
TAGTGCATTACTAATACATCAACAATGACTACGGTTTGTTGATCCAATCTGCTGCTCACCGAAGCTATTCAGTAGACCTGCTGGACGGTCTACTTTGCTA
AGATAGCCGCTTCAGATGTTCGTACGAGAATATGACGTTCGTTCATGACTGCAATCCAGGATATATCGGGATCACACTACTTCACTTCCACGACATAAGC
TGGTCTTCATAGGCCGTATTCGCTTGAGTGATTGTTTCATTTCATACTTGCCATTTGTTGAGTCAAATACACGCCCTCTTGACCAGCGCCTTGATTGAAT
ACTCCTATAACCATATTAAACCTGG